Add more scientific skills

scientific-packages/biopython/scripts/sequence_operations.py

@@ -0,0 +1,125 @@
+#!/usr/bin/env python3
+"""
+Common sequence operations using BioPython.
+
+This script demonstrates basic sequence manipulation tasks like:
+- Creating and manipulating Seq objects
+- Transcription and translation
+- Complement and reverse complement
+- Calculating GC content and melting temperature
+"""
+
+from Bio.Seq import Seq
+from Bio.SeqUtils import gc_fraction, MeltingTemp as mt
+
+
+def demonstrate_seq_operations():
+    """Show common Seq object operations."""
+
+    # Create DNA sequence
+    dna_seq = Seq("ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTG")
+
+    print("Original DNA sequence:")
+    print(dna_seq)
+    print()
+
+    # Transcription (DNA -> RNA)
+    rna_seq = dna_seq.transcribe()
+    print("Transcribed to RNA:")
+    print(rna_seq)
+    print()
+
+    # Translation (DNA -> Protein)
+    protein_seq = dna_seq.translate()
+    print("Translated to protein:")
+    print(protein_seq)
+    print()
+
+    # Translation with stop codon handling
+    protein_to_stop = dna_seq.translate(to_stop=True)
+    print("Translated to first stop codon:")
+    print(protein_to_stop)
+    print()
+
+    # Complement
+    complement = dna_seq.complement()
+    print("Complement:")
+    print(complement)
+    print()
+
+    # Reverse complement
+    reverse_complement = dna_seq.reverse_complement()
+    print("Reverse complement:")
+    print(reverse_complement)
+    print()
+
+    # GC content
+    gc = gc_fraction(dna_seq) * 100
+    print(f"GC content: {gc:.2f}%")
+    print()
+
+    # Melting temperature
+    tm = mt.Tm_NN(dna_seq)
+    print(f"Melting temperature (nearest-neighbor): {tm:.2f}°C")
+    print()
+
+    # Sequence searching
+    codon_start = dna_seq.find("ATG")
+    print(f"Start codon (ATG) position: {codon_start}")
+
+    # Count occurrences
+    g_count = dna_seq.count("G")
+    print(f"Number of G nucleotides: {g_count}")
+    print()
+
+
+def translate_with_genetic_code():
+    """Demonstrate translation with different genetic codes."""
+
+    dna_seq = Seq("ATGGTGCATCTGACTCCTGAGGAGAAGTCT")
+
+    # Standard genetic code (table 1)
+    standard = dna_seq.translate(table=1)
+    print("Standard genetic code translation:")
+    print(standard)
+
+    # Vertebrate mitochondrial code (table 2)
+    mito = dna_seq.translate(table=2)
+    print("Vertebrate mitochondrial code translation:")
+    print(mito)
+    print()
+
+
+def working_with_codons():
+    """Access genetic code tables."""
+    from Bio.Data import CodonTable
+
+    # Get standard genetic code
+    standard_table = CodonTable.unambiguous_dna_by_id[1]
+
+    print("Standard genetic code:")
+    print(f"Start codons: {standard_table.start_codons}")
+    print(f"Stop codons: {standard_table.stop_codons}")
+    print()
+
+    # Show some codon translations
+    print("Example codons:")
+    for codon in ["ATG", "TGG", "TAA", "TAG", "TGA"]:
+        if codon in standard_table.stop_codons:
+            print(f"{codon} -> STOP")
+        else:
+            aa = standard_table.forward_table.get(codon, "Unknown")
+            print(f"{codon} -> {aa}")
+
+
+if __name__ == "__main__":
+    print("=" * 60)
+    print("BioPython Sequence Operations Demo")
+    print("=" * 60)
+    print()
+
+    demonstrate_seq_operations()
+    print("-" * 60)
+    translate_with_genetic_code()
+    print("-" * 60)
+    working_with_codons()