mirror of
https://github.com/K-Dense-AI/claude-scientific-skills.git
synced 2026-01-26 16:58:56 +08:00
Consolidate skills
This commit is contained in:
577
scientific-skills/biopython/references/advanced.md
Normal file
577
scientific-skills/biopython/references/advanced.md
Normal file
@@ -0,0 +1,577 @@
|
||||
# Advanced Biopython Features
|
||||
|
||||
## Sequence Motifs with Bio.motifs
|
||||
|
||||
### Creating Motifs
|
||||
|
||||
```python
|
||||
from Bio import motifs
|
||||
from Bio.Seq import Seq
|
||||
|
||||
# Create motif from instances
|
||||
instances = [
|
||||
Seq("TACAA"),
|
||||
Seq("TACGC"),
|
||||
Seq("TACAC"),
|
||||
Seq("TACCC"),
|
||||
Seq("AACCC"),
|
||||
Seq("AATGC"),
|
||||
Seq("AATGC"),
|
||||
]
|
||||
|
||||
motif = motifs.create(instances)
|
||||
```
|
||||
|
||||
### Motif Consensus and Degenerate Sequences
|
||||
|
||||
```python
|
||||
# Get consensus sequence
|
||||
print(motif.counts.consensus)
|
||||
|
||||
# Get degenerate consensus (IUPAC ambiguity codes)
|
||||
print(motif.counts.degenerate_consensus)
|
||||
|
||||
# Access counts matrix
|
||||
print(motif.counts)
|
||||
```
|
||||
|
||||
### Position Weight Matrix (PWM)
|
||||
|
||||
```python
|
||||
# Create position weight matrix
|
||||
pwm = motif.counts.normalize(pseudocounts=0.5)
|
||||
print(pwm)
|
||||
|
||||
# Calculate information content
|
||||
ic = motif.counts.information_content()
|
||||
print(f"Information content: {ic:.2f} bits")
|
||||
```
|
||||
|
||||
### Searching for Motifs
|
||||
|
||||
```python
|
||||
from Bio.Seq import Seq
|
||||
|
||||
# Search sequence for motif
|
||||
test_seq = Seq("ATACAGGACAGACATACGCATACAACATTACAC")
|
||||
|
||||
# Get Position Specific Scoring Matrix (PSSM)
|
||||
pssm = pwm.log_odds()
|
||||
|
||||
# Search sequence
|
||||
for position, score in pssm.search(test_seq, threshold=5.0):
|
||||
print(f"Position {position}: score = {score:.2f}")
|
||||
```
|
||||
|
||||
### Reading Motifs from Files
|
||||
|
||||
```python
|
||||
# Read motif from JASPAR format
|
||||
with open("motif.jaspar") as handle:
|
||||
motif = motifs.read(handle, "jaspar")
|
||||
|
||||
# Read multiple motifs
|
||||
with open("motifs.jaspar") as handle:
|
||||
for m in motifs.parse(handle, "jaspar"):
|
||||
print(m.name)
|
||||
|
||||
# Supported formats: jaspar, meme, transfac, pfm
|
||||
```
|
||||
|
||||
### Writing Motifs
|
||||
|
||||
```python
|
||||
# Write motif in JASPAR format
|
||||
with open("output.jaspar", "w") as handle:
|
||||
handle.write(motif.format("jaspar"))
|
||||
```
|
||||
|
||||
## Population Genetics with Bio.PopGen
|
||||
|
||||
### Working with GenePop Files
|
||||
|
||||
```python
|
||||
from Bio.PopGen import GenePop
|
||||
|
||||
# Read GenePop file
|
||||
with open("data.gen") as handle:
|
||||
record = GenePop.read(handle)
|
||||
|
||||
# Access populations
|
||||
print(f"Number of populations: {len(record.populations)}")
|
||||
print(f"Loci: {record.loci_list}")
|
||||
|
||||
# Iterate through populations
|
||||
for pop_idx, pop in enumerate(record.populations):
|
||||
print(f"\nPopulation {pop_idx + 1}:")
|
||||
for individual in pop:
|
||||
print(f" {individual[0]}: {individual[1]}")
|
||||
```
|
||||
|
||||
### Calculating Population Statistics
|
||||
|
||||
```python
|
||||
from Bio.PopGen.GenePop.Controller import GenePopController
|
||||
|
||||
# Create controller
|
||||
ctrl = GenePopController()
|
||||
|
||||
# Calculate basic statistics
|
||||
result = ctrl.calc_allele_genotype_freqs("data.gen")
|
||||
|
||||
# Calculate Fst
|
||||
fst_result = ctrl.calc_fst_all("data.gen")
|
||||
print(f"Fst: {fst_result}")
|
||||
|
||||
# Test Hardy-Weinberg equilibrium
|
||||
hw_result = ctrl.test_hw_pop("data.gen", "probability")
|
||||
```
|
||||
|
||||
## Sequence Utilities with Bio.SeqUtils
|
||||
|
||||
### GC Content
|
||||
|
||||
```python
|
||||
from Bio.SeqUtils import gc_fraction
|
||||
from Bio.Seq import Seq
|
||||
|
||||
seq = Seq("ATCGATCGATCG")
|
||||
gc = gc_fraction(seq)
|
||||
print(f"GC content: {gc:.2%}")
|
||||
```
|
||||
|
||||
### Molecular Weight
|
||||
|
||||
```python
|
||||
from Bio.SeqUtils import molecular_weight
|
||||
|
||||
# DNA molecular weight
|
||||
dna_seq = Seq("ATCG")
|
||||
mw = molecular_weight(dna_seq, seq_type="DNA")
|
||||
print(f"DNA MW: {mw:.2f} g/mol")
|
||||
|
||||
# Protein molecular weight
|
||||
protein_seq = Seq("ACDEFGHIKLMNPQRSTVWY")
|
||||
mw = molecular_weight(protein_seq, seq_type="protein")
|
||||
print(f"Protein MW: {mw:.2f} Da")
|
||||
```
|
||||
|
||||
### Melting Temperature
|
||||
|
||||
```python
|
||||
from Bio.SeqUtils import MeltingTemp as mt
|
||||
|
||||
# Calculate Tm using nearest-neighbor method
|
||||
seq = Seq("ATCGATCGATCG")
|
||||
tm = mt.Tm_NN(seq)
|
||||
print(f"Tm: {tm:.1f}°C")
|
||||
|
||||
# Use different salt concentration
|
||||
tm = mt.Tm_NN(seq, Na=50, Mg=1.5) # 50 mM Na+, 1.5 mM Mg2+
|
||||
|
||||
# Wallace rule (for primers)
|
||||
tm_wallace = mt.Tm_Wallace(seq)
|
||||
```
|
||||
|
||||
### GC Skew
|
||||
|
||||
```python
|
||||
from Bio.SeqUtils import gc_skew
|
||||
|
||||
# Calculate GC skew
|
||||
seq = Seq("ATCGATCGGGCCCAAATTT")
|
||||
skew = gc_skew(seq, window=100)
|
||||
print(f"GC skew: {skew}")
|
||||
```
|
||||
|
||||
### ProtParam - Protein Analysis
|
||||
|
||||
```python
|
||||
from Bio.SeqUtils.ProtParam import ProteinAnalysis
|
||||
|
||||
protein_seq = "ACDEFGHIKLMNPQRSTVWY"
|
||||
analyzed_seq = ProteinAnalysis(protein_seq)
|
||||
|
||||
# Molecular weight
|
||||
print(f"MW: {analyzed_seq.molecular_weight():.2f} Da")
|
||||
|
||||
# Isoelectric point
|
||||
print(f"pI: {analyzed_seq.isoelectric_point():.2f}")
|
||||
|
||||
# Amino acid composition
|
||||
print(f"Composition: {analyzed_seq.get_amino_acids_percent()}")
|
||||
|
||||
# Instability index
|
||||
print(f"Instability: {analyzed_seq.instability_index():.2f}")
|
||||
|
||||
# Aromaticity
|
||||
print(f"Aromaticity: {analyzed_seq.aromaticity():.2f}")
|
||||
|
||||
# Secondary structure fraction
|
||||
ss = analyzed_seq.secondary_structure_fraction()
|
||||
print(f"Helix: {ss[0]:.2%}, Turn: {ss[1]:.2%}, Sheet: {ss[2]:.2%}")
|
||||
|
||||
# Extinction coefficient (assumes Cys reduced, no disulfide bonds)
|
||||
print(f"Extinction coefficient: {analyzed_seq.molar_extinction_coefficient()}")
|
||||
|
||||
# Gravy (grand average of hydropathy)
|
||||
print(f"GRAVY: {analyzed_seq.gravy():.3f}")
|
||||
```
|
||||
|
||||
## Restriction Analysis with Bio.Restriction
|
||||
|
||||
```python
|
||||
from Bio import Restriction
|
||||
from Bio.Seq import Seq
|
||||
|
||||
# Analyze sequence for restriction sites
|
||||
seq = Seq("GAATTCATCGATCGATGAATTC")
|
||||
|
||||
# Use specific enzyme
|
||||
ecori = Restriction.EcoRI
|
||||
sites = ecori.search(seq)
|
||||
print(f"EcoRI sites at: {sites}")
|
||||
|
||||
# Use multiple enzymes
|
||||
rb = Restriction.RestrictionBatch(["EcoRI", "BamHI", "PstI"])
|
||||
results = rb.search(seq)
|
||||
for enzyme, sites in results.items():
|
||||
if sites:
|
||||
print(f"{enzyme}: {sites}")
|
||||
|
||||
# Get all enzymes that cut sequence
|
||||
all_enzymes = Restriction.Analysis(rb, seq)
|
||||
print(f"Cutting enzymes: {all_enzymes.with_sites()}")
|
||||
```
|
||||
|
||||
## Sequence Translation Tables
|
||||
|
||||
```python
|
||||
from Bio.Data import CodonTable
|
||||
|
||||
# Standard genetic code
|
||||
standard_table = CodonTable.unambiguous_dna_by_id[1]
|
||||
print(standard_table)
|
||||
|
||||
# Mitochondrial code
|
||||
mito_table = CodonTable.unambiguous_dna_by_id[2]
|
||||
|
||||
# Get specific codon
|
||||
print(f"ATG codes for: {standard_table.forward_table['ATG']}")
|
||||
|
||||
# Get stop codons
|
||||
print(f"Stop codons: {standard_table.stop_codons}")
|
||||
|
||||
# Get start codons
|
||||
print(f"Start codons: {standard_table.start_codons}")
|
||||
```
|
||||
|
||||
## Cluster Analysis with Bio.Cluster
|
||||
|
||||
```python
|
||||
from Bio.Cluster import kcluster
|
||||
import numpy as np
|
||||
|
||||
# Sample data matrix (genes x conditions)
|
||||
data = np.array([
|
||||
[1.2, 0.8, 0.5, 1.5],
|
||||
[0.9, 1.1, 0.7, 1.3],
|
||||
[0.2, 0.3, 2.1, 2.5],
|
||||
[0.1, 0.4, 2.3, 2.2],
|
||||
])
|
||||
|
||||
# Perform k-means clustering
|
||||
clusterid, error, nfound = kcluster(data, nclusters=2)
|
||||
print(f"Cluster assignments: {clusterid}")
|
||||
print(f"Error: {error}")
|
||||
```
|
||||
|
||||
## Genome Diagrams with GenomeDiagram
|
||||
|
||||
```python
|
||||
from Bio.Graphics import GenomeDiagram
|
||||
from Bio.SeqFeature import SeqFeature, FeatureLocation
|
||||
from Bio import SeqIO
|
||||
from reportlab.lib import colors
|
||||
|
||||
# Read GenBank file
|
||||
record = SeqIO.read("sequence.gb", "genbank")
|
||||
|
||||
# Create diagram
|
||||
gd_diagram = GenomeDiagram.Diagram("Genome Diagram")
|
||||
gd_track = gd_diagram.new_track(1, greytrack=True)
|
||||
gd_feature_set = gd_track.new_set()
|
||||
|
||||
# Add features
|
||||
for feature in record.features:
|
||||
if feature.type == "CDS":
|
||||
color = colors.blue
|
||||
elif feature.type == "gene":
|
||||
color = colors.lightblue
|
||||
else:
|
||||
color = colors.grey
|
||||
|
||||
gd_feature_set.add_feature(
|
||||
feature,
|
||||
color=color,
|
||||
label=True,
|
||||
label_size=6,
|
||||
label_angle=45
|
||||
)
|
||||
|
||||
# Draw and save
|
||||
gd_diagram.draw(format="linear", pagesize="A4", fragments=1)
|
||||
gd_diagram.write("genome_diagram.pdf", "PDF")
|
||||
```
|
||||
|
||||
## Sequence Comparison with Bio.pairwise2
|
||||
|
||||
**Note**: Bio.pairwise2 is deprecated. Use Bio.Align.PairwiseAligner instead (see alignment.md).
|
||||
|
||||
However, for legacy code:
|
||||
|
||||
```python
|
||||
from Bio import pairwise2
|
||||
from Bio.pairwise2 import format_alignment
|
||||
|
||||
# Global alignment
|
||||
alignments = pairwise2.align.globalxx("ACCGT", "ACGT")
|
||||
|
||||
# Print top alignments
|
||||
for alignment in alignments[:3]:
|
||||
print(format_alignment(*alignment))
|
||||
```
|
||||
|
||||
## Working with PubChem
|
||||
|
||||
```python
|
||||
from Bio import Entrez
|
||||
|
||||
Entrez.email = "your.email@example.com"
|
||||
|
||||
# Search PubChem
|
||||
handle = Entrez.esearch(db="pccompound", term="aspirin")
|
||||
result = Entrez.read(handle)
|
||||
handle.close()
|
||||
|
||||
compound_id = result["IdList"][0]
|
||||
|
||||
# Get compound information
|
||||
handle = Entrez.efetch(db="pccompound", id=compound_id, retmode="xml")
|
||||
compound_data = handle.read()
|
||||
handle.close()
|
||||
```
|
||||
|
||||
## Sequence Features with Bio.SeqFeature
|
||||
|
||||
```python
|
||||
from Bio.SeqFeature import SeqFeature, FeatureLocation
|
||||
from Bio.Seq import Seq
|
||||
from Bio.SeqRecord import SeqRecord
|
||||
|
||||
# Create a feature
|
||||
feature = SeqFeature(
|
||||
location=FeatureLocation(start=10, end=50),
|
||||
type="CDS",
|
||||
strand=1,
|
||||
qualifiers={"gene": ["ABC1"], "product": ["ABC protein"]}
|
||||
)
|
||||
|
||||
# Add feature to record
|
||||
record = SeqRecord(Seq("ATCG" * 20), id="seq1")
|
||||
record.features.append(feature)
|
||||
|
||||
# Extract feature sequence
|
||||
feature_seq = feature.extract(record.seq)
|
||||
print(feature_seq)
|
||||
```
|
||||
|
||||
## Sequence Ambiguity
|
||||
|
||||
```python
|
||||
from Bio.Data import IUPACData
|
||||
|
||||
# DNA ambiguity codes
|
||||
print(IUPACData.ambiguous_dna_letters)
|
||||
|
||||
# Protein ambiguity codes
|
||||
print(IUPACData.ambiguous_protein_letters)
|
||||
|
||||
# Resolve ambiguous bases
|
||||
print(IUPACData.ambiguous_dna_values["N"]) # Any base
|
||||
print(IUPACData.ambiguous_dna_values["R"]) # A or G
|
||||
```
|
||||
|
||||
## Quality Scores (FASTQ)
|
||||
|
||||
```python
|
||||
from Bio import SeqIO
|
||||
|
||||
# Read FASTQ with quality scores
|
||||
for record in SeqIO.parse("reads.fastq", "fastq"):
|
||||
print(f"ID: {record.id}")
|
||||
print(f"Sequence: {record.seq}")
|
||||
print(f"Quality: {record.letter_annotations['phred_quality']}")
|
||||
|
||||
# Calculate average quality
|
||||
avg_quality = sum(record.letter_annotations['phred_quality']) / len(record)
|
||||
print(f"Average quality: {avg_quality:.2f}")
|
||||
|
||||
# Filter by quality
|
||||
min_quality = min(record.letter_annotations['phred_quality'])
|
||||
if min_quality >= 20:
|
||||
print("High quality read")
|
||||
```
|
||||
|
||||
## Best Practices
|
||||
|
||||
1. **Use appropriate modules** - Choose the right tool for your analysis
|
||||
2. **Handle pseudocounts** - Important for motif analysis
|
||||
3. **Validate input data** - Check file formats and data quality
|
||||
4. **Consider performance** - Some operations can be computationally intensive
|
||||
5. **Cache results** - Store intermediate results for large analyses
|
||||
6. **Use proper genetic codes** - Select appropriate translation tables
|
||||
7. **Document parameters** - Record thresholds and settings used
|
||||
8. **Validate statistical results** - Understand limitations of tests
|
||||
9. **Handle edge cases** - Check for empty results or invalid input
|
||||
10. **Combine modules** - Leverage multiple Biopython tools together
|
||||
|
||||
## Common Use Cases
|
||||
|
||||
### Find ORFs
|
||||
|
||||
```python
|
||||
from Bio import SeqIO
|
||||
from Bio.SeqUtils import gc_fraction
|
||||
|
||||
def find_orfs(seq, min_length=100):
|
||||
"""Find all ORFs in sequence."""
|
||||
orfs = []
|
||||
|
||||
for strand, nuc in [(+1, seq), (-1, seq.reverse_complement())]:
|
||||
for frame in range(3):
|
||||
trans = nuc[frame:].translate()
|
||||
trans_len = len(trans)
|
||||
|
||||
aa_start = 0
|
||||
while aa_start < trans_len:
|
||||
aa_end = trans.find("*", aa_start)
|
||||
if aa_end == -1:
|
||||
aa_end = trans_len
|
||||
|
||||
if aa_end - aa_start >= min_length // 3:
|
||||
start = frame + aa_start * 3
|
||||
end = frame + aa_end * 3
|
||||
orfs.append({
|
||||
'start': start,
|
||||
'end': end,
|
||||
'strand': strand,
|
||||
'frame': frame,
|
||||
'length': end - start,
|
||||
'sequence': nuc[start:end]
|
||||
})
|
||||
|
||||
aa_start = aa_end + 1
|
||||
|
||||
return orfs
|
||||
|
||||
# Use it
|
||||
record = SeqIO.read("sequence.fasta", "fasta")
|
||||
orfs = find_orfs(record.seq, min_length=300)
|
||||
for orf in orfs:
|
||||
print(f"ORF: {orf['start']}-{orf['end']}, strand={orf['strand']}, length={orf['length']}")
|
||||
```
|
||||
|
||||
### Analyze Codon Usage
|
||||
|
||||
```python
|
||||
from Bio import SeqIO
|
||||
from Bio.SeqUtils import CodonUsage
|
||||
|
||||
def analyze_codon_usage(fasta_file):
|
||||
"""Analyze codon usage in coding sequences."""
|
||||
codon_counts = {}
|
||||
|
||||
for record in SeqIO.parse(fasta_file, "fasta"):
|
||||
# Ensure sequence is multiple of 3
|
||||
seq = record.seq[:len(record.seq) - len(record.seq) % 3]
|
||||
|
||||
# Count codons
|
||||
for i in range(0, len(seq), 3):
|
||||
codon = str(seq[i:i+3])
|
||||
codon_counts[codon] = codon_counts.get(codon, 0) + 1
|
||||
|
||||
# Calculate frequencies
|
||||
total = sum(codon_counts.values())
|
||||
codon_freq = {k: v/total for k, v in codon_counts.items()}
|
||||
|
||||
return codon_freq
|
||||
```
|
||||
|
||||
### Calculate Sequence Complexity
|
||||
|
||||
```python
|
||||
def sequence_complexity(seq, k=2):
|
||||
"""Calculate k-mer complexity (Shannon entropy)."""
|
||||
import math
|
||||
from collections import Counter
|
||||
|
||||
# Generate k-mers
|
||||
kmers = [str(seq[i:i+k]) for i in range(len(seq) - k + 1)]
|
||||
|
||||
# Count k-mers
|
||||
counts = Counter(kmers)
|
||||
total = len(kmers)
|
||||
|
||||
# Calculate entropy
|
||||
entropy = 0
|
||||
for count in counts.values():
|
||||
freq = count / total
|
||||
entropy -= freq * math.log2(freq)
|
||||
|
||||
# Normalize by maximum possible entropy
|
||||
max_entropy = math.log2(4 ** k) # For DNA
|
||||
|
||||
return entropy / max_entropy if max_entropy > 0 else 0
|
||||
|
||||
# Use it
|
||||
from Bio.Seq import Seq
|
||||
seq = Seq("ATCGATCGATCGATCG")
|
||||
complexity = sequence_complexity(seq, k=2)
|
||||
print(f"Sequence complexity: {complexity:.3f}")
|
||||
```
|
||||
|
||||
### Extract Promoter Regions
|
||||
|
||||
```python
|
||||
def extract_promoters(genbank_file, upstream=500):
|
||||
"""Extract promoter regions upstream of genes."""
|
||||
from Bio import SeqIO
|
||||
|
||||
record = SeqIO.read(genbank_file, "genbank")
|
||||
promoters = []
|
||||
|
||||
for feature in record.features:
|
||||
if feature.type == "gene":
|
||||
if feature.strand == 1:
|
||||
# Forward strand
|
||||
start = max(0, feature.location.start - upstream)
|
||||
end = feature.location.start
|
||||
else:
|
||||
# Reverse strand
|
||||
start = feature.location.end
|
||||
end = min(len(record.seq), feature.location.end + upstream)
|
||||
|
||||
promoter_seq = record.seq[start:end]
|
||||
if feature.strand == -1:
|
||||
promoter_seq = promoter_seq.reverse_complement()
|
||||
|
||||
promoters.append({
|
||||
'gene': feature.qualifiers.get('gene', ['Unknown'])[0],
|
||||
'sequence': promoter_seq,
|
||||
'start': start,
|
||||
'end': end
|
||||
})
|
||||
|
||||
return promoters
|
||||
```
|
||||
362
scientific-skills/biopython/references/alignment.md
Normal file
362
scientific-skills/biopython/references/alignment.md
Normal file
@@ -0,0 +1,362 @@
|
||||
# Sequence Alignments with Bio.Align and Bio.AlignIO
|
||||
|
||||
## Overview
|
||||
|
||||
Bio.Align provides tools for pairwise sequence alignment using various algorithms, while Bio.AlignIO handles reading and writing multiple sequence alignment files in various formats.
|
||||
|
||||
## Pairwise Alignment with Bio.Align
|
||||
|
||||
### The PairwiseAligner Class
|
||||
|
||||
The `PairwiseAligner` class performs pairwise sequence alignments using Needleman-Wunsch (global), Smith-Waterman (local), Gotoh (three-state), and Waterman-Smith-Beyer algorithms. The appropriate algorithm is automatically selected based on gap score parameters.
|
||||
|
||||
### Creating an Aligner
|
||||
|
||||
```python
|
||||
from Bio import Align
|
||||
|
||||
# Create aligner with default parameters
|
||||
aligner = Align.PairwiseAligner()
|
||||
|
||||
# Default scores (as of Biopython 1.85+):
|
||||
# - Match score: +1.0
|
||||
# - Mismatch score: 0.0
|
||||
# - All gap scores: -1.0
|
||||
```
|
||||
|
||||
### Customizing Alignment Parameters
|
||||
|
||||
```python
|
||||
# Set scoring parameters
|
||||
aligner.match_score = 2.0
|
||||
aligner.mismatch_score = -1.0
|
||||
aligner.gap_score = -0.5
|
||||
|
||||
# Or use separate gap opening/extension penalties
|
||||
aligner.open_gap_score = -2.0
|
||||
aligner.extend_gap_score = -0.5
|
||||
|
||||
# Set internal gap scores separately
|
||||
aligner.internal_open_gap_score = -2.0
|
||||
aligner.internal_extend_gap_score = -0.5
|
||||
|
||||
# Set end gap scores (for semi-global alignment)
|
||||
aligner.left_open_gap_score = 0.0
|
||||
aligner.left_extend_gap_score = 0.0
|
||||
aligner.right_open_gap_score = 0.0
|
||||
aligner.right_extend_gap_score = 0.0
|
||||
```
|
||||
|
||||
### Alignment Modes
|
||||
|
||||
```python
|
||||
# Global alignment (default)
|
||||
aligner.mode = 'global'
|
||||
|
||||
# Local alignment
|
||||
aligner.mode = 'local'
|
||||
```
|
||||
|
||||
### Performing Alignments
|
||||
|
||||
```python
|
||||
from Bio.Seq import Seq
|
||||
|
||||
seq1 = Seq("ACCGGT")
|
||||
seq2 = Seq("ACGGT")
|
||||
|
||||
# Get all optimal alignments
|
||||
alignments = aligner.align(seq1, seq2)
|
||||
|
||||
# Iterate through alignments
|
||||
for alignment in alignments:
|
||||
print(alignment)
|
||||
print(f"Score: {alignment.score}")
|
||||
|
||||
# Get just the score
|
||||
score = aligner.score(seq1, seq2)
|
||||
```
|
||||
|
||||
### Using Substitution Matrices
|
||||
|
||||
```python
|
||||
from Bio.Align import substitution_matrices
|
||||
|
||||
# Load a substitution matrix
|
||||
matrix = substitution_matrices.load("BLOSUM62")
|
||||
aligner.substitution_matrix = matrix
|
||||
|
||||
# Align protein sequences
|
||||
protein1 = Seq("KEVLA")
|
||||
protein2 = Seq("KSVLA")
|
||||
alignments = aligner.align(protein1, protein2)
|
||||
```
|
||||
|
||||
### Available Substitution Matrices
|
||||
|
||||
Common matrices include:
|
||||
- **BLOSUM** series (BLOSUM45, BLOSUM50, BLOSUM62, BLOSUM80, BLOSUM90)
|
||||
- **PAM** series (PAM30, PAM70, PAM250)
|
||||
- **MATCH** - Simple match/mismatch matrix
|
||||
|
||||
```python
|
||||
# List available matrices
|
||||
available = substitution_matrices.load()
|
||||
print(available)
|
||||
```
|
||||
|
||||
## Multiple Sequence Alignments with Bio.AlignIO
|
||||
|
||||
### Reading Alignments
|
||||
|
||||
Bio.AlignIO provides similar API to Bio.SeqIO but for alignment files:
|
||||
|
||||
```python
|
||||
from Bio import AlignIO
|
||||
|
||||
# Read a single alignment
|
||||
alignment = AlignIO.read("alignment.aln", "clustal")
|
||||
|
||||
# Parse multiple alignments from a file
|
||||
for alignment in AlignIO.parse("alignments.aln", "clustal"):
|
||||
print(f"Alignment with {len(alignment)} sequences")
|
||||
print(f"Alignment length: {alignment.get_alignment_length()}")
|
||||
```
|
||||
|
||||
### Supported Alignment Formats
|
||||
|
||||
Common formats include:
|
||||
- **clustal** - Clustal format
|
||||
- **phylip** - PHYLIP format
|
||||
- **phylip-relaxed** - Relaxed PHYLIP (longer names)
|
||||
- **stockholm** - Stockholm format
|
||||
- **fasta** - FASTA format (aligned)
|
||||
- **nexus** - NEXUS format
|
||||
- **emboss** - EMBOSS alignment format
|
||||
- **msf** - MSF format
|
||||
- **maf** - Multiple Alignment Format
|
||||
|
||||
### Writing Alignments
|
||||
|
||||
```python
|
||||
# Write alignment to file
|
||||
AlignIO.write(alignment, "output.aln", "clustal")
|
||||
|
||||
# Convert between formats
|
||||
count = AlignIO.convert("input.aln", "clustal", "output.phy", "phylip")
|
||||
```
|
||||
|
||||
### Working with Alignment Objects
|
||||
|
||||
```python
|
||||
from Bio import AlignIO
|
||||
|
||||
alignment = AlignIO.read("alignment.aln", "clustal")
|
||||
|
||||
# Get alignment properties
|
||||
print(f"Number of sequences: {len(alignment)}")
|
||||
print(f"Alignment length: {alignment.get_alignment_length()}")
|
||||
|
||||
# Access individual sequences
|
||||
for record in alignment:
|
||||
print(f"{record.id}: {record.seq}")
|
||||
|
||||
# Get alignment column
|
||||
column = alignment[:, 0] # First column
|
||||
|
||||
# Get alignment slice
|
||||
sub_alignment = alignment[:, 10:20] # Positions 10-20
|
||||
|
||||
# Get specific sequence
|
||||
seq_record = alignment[0] # First sequence
|
||||
```
|
||||
|
||||
### Alignment Analysis
|
||||
|
||||
```python
|
||||
# Calculate alignment statistics
|
||||
from Bio.Align import AlignInfo
|
||||
|
||||
summary = AlignInfo.SummaryInfo(alignment)
|
||||
|
||||
# Get consensus sequence
|
||||
consensus = summary.gap_consensus(threshold=0.7)
|
||||
|
||||
# Position-specific scoring matrix (PSSM)
|
||||
pssm = summary.pos_specific_score_matrix(consensus)
|
||||
|
||||
# Calculate information content
|
||||
from Bio import motifs
|
||||
motif = motifs.create([record.seq for record in alignment])
|
||||
information = motif.counts.information_content()
|
||||
```
|
||||
|
||||
## Creating Alignments Programmatically
|
||||
|
||||
### From SeqRecord Objects
|
||||
|
||||
```python
|
||||
from Bio.Align import MultipleSeqAlignment
|
||||
from Bio.SeqRecord import SeqRecord
|
||||
from Bio.Seq import Seq
|
||||
|
||||
# Create records
|
||||
records = [
|
||||
SeqRecord(Seq("ACTGCTAGCTAG"), id="seq1"),
|
||||
SeqRecord(Seq("ACT-CTAGCTAG"), id="seq2"),
|
||||
SeqRecord(Seq("ACTGCTA-CTAG"), id="seq3"),
|
||||
]
|
||||
|
||||
# Create alignment
|
||||
alignment = MultipleSeqAlignment(records)
|
||||
```
|
||||
|
||||
### Adding Sequences to Alignments
|
||||
|
||||
```python
|
||||
# Start with empty alignment
|
||||
alignment = MultipleSeqAlignment([])
|
||||
|
||||
# Add sequences (must have same length)
|
||||
alignment.append(SeqRecord(Seq("ACTG"), id="seq1"))
|
||||
alignment.append(SeqRecord(Seq("ACTG"), id="seq2"))
|
||||
|
||||
# Extend with another alignment
|
||||
alignment.extend(other_alignment)
|
||||
```
|
||||
|
||||
## Advanced Alignment Operations
|
||||
|
||||
### Removing Gaps
|
||||
|
||||
```python
|
||||
# Remove all gap-only columns
|
||||
from Bio.Align import AlignInfo
|
||||
|
||||
no_gaps = []
|
||||
for i in range(alignment.get_alignment_length()):
|
||||
column = alignment[:, i]
|
||||
if set(column) != {'-'}: # Not all gaps
|
||||
no_gaps.append(column)
|
||||
```
|
||||
|
||||
### Alignment Sorting
|
||||
|
||||
```python
|
||||
# Sort by sequence ID
|
||||
sorted_alignment = sorted(alignment, key=lambda x: x.id)
|
||||
alignment = MultipleSeqAlignment(sorted_alignment)
|
||||
```
|
||||
|
||||
### Computing Pairwise Identities
|
||||
|
||||
```python
|
||||
def pairwise_identity(seq1, seq2):
|
||||
"""Calculate percent identity between two sequences."""
|
||||
matches = sum(a == b for a, b in zip(seq1, seq2) if a != '-' and b != '-')
|
||||
length = sum(1 for a, b in zip(seq1, seq2) if a != '-' and b != '-')
|
||||
return matches / length if length > 0 else 0
|
||||
|
||||
# Calculate all pairwise identities
|
||||
for i, record1 in enumerate(alignment):
|
||||
for record2 in alignment[i+1:]:
|
||||
identity = pairwise_identity(record1.seq, record2.seq)
|
||||
print(f"{record1.id} vs {record2.id}: {identity:.2%}")
|
||||
```
|
||||
|
||||
## Running External Alignment Tools
|
||||
|
||||
### Clustal Omega (via Command Line)
|
||||
|
||||
```python
|
||||
from Bio.Align.Applications import ClustalOmegaCommandline
|
||||
|
||||
# Setup command
|
||||
clustal_cmd = ClustalOmegaCommandline(
|
||||
infile="sequences.fasta",
|
||||
outfile="alignment.aln",
|
||||
verbose=True,
|
||||
auto=True
|
||||
)
|
||||
|
||||
# Run alignment
|
||||
stdout, stderr = clustal_cmd()
|
||||
|
||||
# Read result
|
||||
alignment = AlignIO.read("alignment.aln", "clustal")
|
||||
```
|
||||
|
||||
### MUSCLE (via Command Line)
|
||||
|
||||
```python
|
||||
from Bio.Align.Applications import MuscleCommandline
|
||||
|
||||
muscle_cmd = MuscleCommandline(
|
||||
input="sequences.fasta",
|
||||
out="alignment.aln"
|
||||
)
|
||||
stdout, stderr = muscle_cmd()
|
||||
```
|
||||
|
||||
## Best Practices
|
||||
|
||||
1. **Choose appropriate scoring schemes** - Use BLOSUM62 for proteins, custom scores for DNA
|
||||
2. **Consider alignment mode** - Global for similar-length sequences, local for finding conserved regions
|
||||
3. **Set gap penalties carefully** - Higher penalties create fewer, longer gaps
|
||||
4. **Use appropriate formats** - FASTA for simple alignments, Stockholm for rich annotation
|
||||
5. **Validate alignment quality** - Check for conserved regions and percent identity
|
||||
6. **Handle large alignments carefully** - Use slicing and iteration for memory efficiency
|
||||
7. **Preserve metadata** - Maintain SeqRecord IDs and annotations through alignment operations
|
||||
|
||||
## Common Use Cases
|
||||
|
||||
### Find Best Local Alignment
|
||||
|
||||
```python
|
||||
from Bio.Align import PairwiseAligner
|
||||
from Bio.Seq import Seq
|
||||
|
||||
aligner = PairwiseAligner()
|
||||
aligner.mode = 'local'
|
||||
aligner.match_score = 2
|
||||
aligner.mismatch_score = -1
|
||||
|
||||
seq1 = Seq("AGCTTAGCTAGCTAGC")
|
||||
seq2 = Seq("CTAGCTAGC")
|
||||
|
||||
alignments = aligner.align(seq1, seq2)
|
||||
print(alignments[0])
|
||||
```
|
||||
|
||||
### Protein Sequence Alignment
|
||||
|
||||
```python
|
||||
from Bio.Align import PairwiseAligner, substitution_matrices
|
||||
|
||||
aligner = PairwiseAligner()
|
||||
aligner.substitution_matrix = substitution_matrices.load("BLOSUM62")
|
||||
aligner.open_gap_score = -10
|
||||
aligner.extend_gap_score = -0.5
|
||||
|
||||
protein1 = Seq("KEVLA")
|
||||
protein2 = Seq("KEVLAEQP")
|
||||
alignments = aligner.align(protein1, protein2)
|
||||
```
|
||||
|
||||
### Extract Conserved Regions
|
||||
|
||||
```python
|
||||
from Bio import AlignIO
|
||||
|
||||
alignment = AlignIO.read("alignment.aln", "clustal")
|
||||
|
||||
# Find columns with >80% identity
|
||||
conserved_positions = []
|
||||
for i in range(alignment.get_alignment_length()):
|
||||
column = alignment[:, i]
|
||||
most_common = max(set(column), key=column.count)
|
||||
if column.count(most_common) / len(column) > 0.8:
|
||||
conserved_positions.append(i)
|
||||
|
||||
print(f"Conserved positions: {conserved_positions}")
|
||||
```
|
||||
455
scientific-skills/biopython/references/blast.md
Normal file
455
scientific-skills/biopython/references/blast.md
Normal file
@@ -0,0 +1,455 @@
|
||||
# BLAST Operations with Bio.Blast
|
||||
|
||||
## Overview
|
||||
|
||||
Bio.Blast provides tools for running BLAST searches (both locally and via NCBI web services) and parsing BLAST results in various formats. The module handles the complexity of submitting queries and parsing outputs.
|
||||
|
||||
## Running BLAST via NCBI Web Services
|
||||
|
||||
### Bio.Blast.NCBIWWW
|
||||
|
||||
The `qblast()` function submits sequences to NCBI's online BLAST service:
|
||||
|
||||
```python
|
||||
from Bio.Blast import NCBIWWW
|
||||
from Bio import SeqIO
|
||||
|
||||
# Read sequence from file
|
||||
record = SeqIO.read("sequence.fasta", "fasta")
|
||||
|
||||
# Run BLAST search
|
||||
result_handle = NCBIWWW.qblast(
|
||||
program="blastn", # BLAST program
|
||||
database="nt", # Database to search
|
||||
sequence=str(record.seq) # Query sequence
|
||||
)
|
||||
|
||||
# Save results
|
||||
with open("blast_results.xml", "w") as out_file:
|
||||
out_file.write(result_handle.read())
|
||||
result_handle.close()
|
||||
```
|
||||
|
||||
### BLAST Programs Available
|
||||
|
||||
- **blastn** - Nucleotide vs nucleotide
|
||||
- **blastp** - Protein vs protein
|
||||
- **blastx** - Translated nucleotide vs protein
|
||||
- **tblastn** - Protein vs translated nucleotide
|
||||
- **tblastx** - Translated nucleotide vs translated nucleotide
|
||||
|
||||
### Common Databases
|
||||
|
||||
**Nucleotide databases:**
|
||||
- `nt` - All GenBank+EMBL+DDBJ+PDB sequences
|
||||
- `refseq_rna` - RefSeq RNA sequences
|
||||
|
||||
**Protein databases:**
|
||||
- `nr` - All non-redundant GenBank CDS translations
|
||||
- `refseq_protein` - RefSeq protein sequences
|
||||
- `pdb` - Protein Data Bank sequences
|
||||
- `swissprot` - Curated UniProtKB/Swiss-Prot
|
||||
|
||||
### Advanced qblast Parameters
|
||||
|
||||
```python
|
||||
result_handle = NCBIWWW.qblast(
|
||||
program="blastn",
|
||||
database="nt",
|
||||
sequence=str(record.seq),
|
||||
expect=0.001, # E-value threshold
|
||||
hitlist_size=50, # Number of hits to return
|
||||
alignments=25, # Number of alignments to show
|
||||
word_size=11, # Word size for initial match
|
||||
gapcosts="5 2", # Gap costs (open extend)
|
||||
format_type="XML" # Output format (default)
|
||||
)
|
||||
```
|
||||
|
||||
### Using Sequence Files or IDs
|
||||
|
||||
```python
|
||||
# Use FASTA format string
|
||||
fasta_string = open("sequence.fasta").read()
|
||||
result_handle = NCBIWWW.qblast("blastn", "nt", fasta_string)
|
||||
|
||||
# Use GenBank ID
|
||||
result_handle = NCBIWWW.qblast("blastn", "nt", "EU490707")
|
||||
|
||||
# Use GI number
|
||||
result_handle = NCBIWWW.qblast("blastn", "nt", "160418")
|
||||
```
|
||||
|
||||
## Parsing BLAST Results
|
||||
|
||||
### Bio.Blast.NCBIXML
|
||||
|
||||
NCBIXML provides parsers for BLAST XML output (the recommended format):
|
||||
|
||||
```python
|
||||
from Bio.Blast import NCBIXML
|
||||
|
||||
# Parse single BLAST result
|
||||
with open("blast_results.xml") as result_handle:
|
||||
blast_record = NCBIXML.read(result_handle)
|
||||
```
|
||||
|
||||
### Accessing BLAST Record Data
|
||||
|
||||
```python
|
||||
# Query information
|
||||
print(f"Query: {blast_record.query}")
|
||||
print(f"Query length: {blast_record.query_length}")
|
||||
print(f"Database: {blast_record.database}")
|
||||
print(f"Number of sequences in database: {blast_record.database_sequences}")
|
||||
|
||||
# Iterate through alignments (hits)
|
||||
for alignment in blast_record.alignments:
|
||||
print(f"\nHit: {alignment.title}")
|
||||
print(f"Length: {alignment.length}")
|
||||
print(f"Accession: {alignment.accession}")
|
||||
|
||||
# Each alignment can have multiple HSPs (high-scoring pairs)
|
||||
for hsp in alignment.hsps:
|
||||
print(f" E-value: {hsp.expect}")
|
||||
print(f" Score: {hsp.score}")
|
||||
print(f" Bits: {hsp.bits}")
|
||||
print(f" Identities: {hsp.identities}/{hsp.align_length}")
|
||||
print(f" Gaps: {hsp.gaps}")
|
||||
print(f" Query: {hsp.query}")
|
||||
print(f" Match: {hsp.match}")
|
||||
print(f" Subject: {hsp.sbjct}")
|
||||
```
|
||||
|
||||
### Filtering Results
|
||||
|
||||
```python
|
||||
# Only show hits with E-value < 0.001
|
||||
E_VALUE_THRESH = 0.001
|
||||
|
||||
for alignment in blast_record.alignments:
|
||||
for hsp in alignment.hsps:
|
||||
if hsp.expect < E_VALUE_THRESH:
|
||||
print(f"Hit: {alignment.title}")
|
||||
print(f"E-value: {hsp.expect}")
|
||||
print(f"Identities: {hsp.identities}/{hsp.align_length}")
|
||||
print()
|
||||
```
|
||||
|
||||
### Multiple BLAST Results
|
||||
|
||||
For files containing multiple BLAST results (e.g., from batch searches):
|
||||
|
||||
```python
|
||||
from Bio.Blast import NCBIXML
|
||||
|
||||
with open("batch_blast_results.xml") as result_handle:
|
||||
blast_records = NCBIXML.parse(result_handle)
|
||||
|
||||
for blast_record in blast_records:
|
||||
print(f"\nQuery: {blast_record.query}")
|
||||
print(f"Hits: {len(blast_record.alignments)}")
|
||||
|
||||
if blast_record.alignments:
|
||||
# Get best hit
|
||||
best_alignment = blast_record.alignments[0]
|
||||
best_hsp = best_alignment.hsps[0]
|
||||
print(f"Best hit: {best_alignment.title}")
|
||||
print(f"E-value: {best_hsp.expect}")
|
||||
```
|
||||
|
||||
## Running Local BLAST
|
||||
|
||||
### Prerequisites
|
||||
|
||||
Local BLAST requires:
|
||||
1. BLAST+ command-line tools installed
|
||||
2. BLAST databases downloaded locally
|
||||
|
||||
### Using Command-Line Wrappers
|
||||
|
||||
```python
|
||||
from Bio.Blast.Applications import NcbiblastnCommandline
|
||||
|
||||
# Setup BLAST command
|
||||
blastn_cline = NcbiblastnCommandline(
|
||||
query="input.fasta",
|
||||
db="local_database",
|
||||
evalue=0.001,
|
||||
outfmt=5, # XML format
|
||||
out="results.xml"
|
||||
)
|
||||
|
||||
# Run BLAST
|
||||
stdout, stderr = blastn_cline()
|
||||
|
||||
# Parse results
|
||||
from Bio.Blast import NCBIXML
|
||||
with open("results.xml") as result_handle:
|
||||
blast_record = NCBIXML.read(result_handle)
|
||||
```
|
||||
|
||||
### Available Command-Line Wrappers
|
||||
|
||||
- `NcbiblastnCommandline` - BLASTN wrapper
|
||||
- `NcbiblastpCommandline` - BLASTP wrapper
|
||||
- `NcbiblastxCommandline` - BLASTX wrapper
|
||||
- `NcbitblastnCommandline` - TBLASTN wrapper
|
||||
- `NcbitblastxCommandline` - TBLASTX wrapper
|
||||
|
||||
### Creating BLAST Databases
|
||||
|
||||
```python
|
||||
from Bio.Blast.Applications import NcbimakeblastdbCommandline
|
||||
|
||||
# Create nucleotide database
|
||||
makedb_cline = NcbimakeblastdbCommandline(
|
||||
input_file="sequences.fasta",
|
||||
dbtype="nucl",
|
||||
out="my_database"
|
||||
)
|
||||
stdout, stderr = makedb_cline()
|
||||
```
|
||||
|
||||
## Analyzing BLAST Results
|
||||
|
||||
### Extract Best Hits
|
||||
|
||||
```python
|
||||
def get_best_hits(blast_record, num_hits=10, e_value_thresh=0.001):
|
||||
"""Extract best hits from BLAST record."""
|
||||
hits = []
|
||||
for alignment in blast_record.alignments[:num_hits]:
|
||||
for hsp in alignment.hsps:
|
||||
if hsp.expect < e_value_thresh:
|
||||
hits.append({
|
||||
'title': alignment.title,
|
||||
'accession': alignment.accession,
|
||||
'length': alignment.length,
|
||||
'e_value': hsp.expect,
|
||||
'score': hsp.score,
|
||||
'identities': hsp.identities,
|
||||
'align_length': hsp.align_length,
|
||||
'query_start': hsp.query_start,
|
||||
'query_end': hsp.query_end,
|
||||
'sbjct_start': hsp.sbjct_start,
|
||||
'sbjct_end': hsp.sbjct_end
|
||||
})
|
||||
break # Only take best HSP per alignment
|
||||
return hits
|
||||
```
|
||||
|
||||
### Calculate Percent Identity
|
||||
|
||||
```python
|
||||
def calculate_percent_identity(hsp):
|
||||
"""Calculate percent identity for an HSP."""
|
||||
return (hsp.identities / hsp.align_length) * 100
|
||||
|
||||
# Use it
|
||||
for alignment in blast_record.alignments:
|
||||
for hsp in alignment.hsps:
|
||||
if hsp.expect < 0.001:
|
||||
identity = calculate_percent_identity(hsp)
|
||||
print(f"{alignment.title}: {identity:.2f}% identity")
|
||||
```
|
||||
|
||||
### Extract Hit Sequences
|
||||
|
||||
```python
|
||||
from Bio import Entrez, SeqIO
|
||||
|
||||
Entrez.email = "your.email@example.com"
|
||||
|
||||
def fetch_hit_sequences(blast_record, num_sequences=5):
|
||||
"""Fetch sequences for top BLAST hits."""
|
||||
sequences = []
|
||||
|
||||
for alignment in blast_record.alignments[:num_sequences]:
|
||||
accession = alignment.accession
|
||||
|
||||
# Fetch sequence from GenBank
|
||||
handle = Entrez.efetch(
|
||||
db="nucleotide",
|
||||
id=accession,
|
||||
rettype="fasta",
|
||||
retmode="text"
|
||||
)
|
||||
record = SeqIO.read(handle, "fasta")
|
||||
handle.close()
|
||||
|
||||
sequences.append(record)
|
||||
|
||||
return sequences
|
||||
```
|
||||
|
||||
## Parsing Other BLAST Formats
|
||||
|
||||
### Tab-Delimited Output (outfmt 6/7)
|
||||
|
||||
```python
|
||||
# Run BLAST with tabular output
|
||||
blastn_cline = NcbiblastnCommandline(
|
||||
query="input.fasta",
|
||||
db="database",
|
||||
outfmt=6,
|
||||
out="results.txt"
|
||||
)
|
||||
|
||||
# Parse tabular results
|
||||
with open("results.txt") as f:
|
||||
for line in f:
|
||||
fields = line.strip().split('\t')
|
||||
query_id = fields[0]
|
||||
subject_id = fields[1]
|
||||
percent_identity = float(fields[2])
|
||||
align_length = int(fields[3])
|
||||
e_value = float(fields[10])
|
||||
bit_score = float(fields[11])
|
||||
|
||||
print(f"{query_id} -> {subject_id}: {percent_identity}% identity, E={e_value}")
|
||||
```
|
||||
|
||||
### Custom Output Formats
|
||||
|
||||
```python
|
||||
# Specify custom columns (outfmt 6 with custom fields)
|
||||
blastn_cline = NcbiblastnCommandline(
|
||||
query="input.fasta",
|
||||
db="database",
|
||||
outfmt="6 qseqid sseqid pident length evalue bitscore qseq sseq",
|
||||
out="results.txt"
|
||||
)
|
||||
```
|
||||
|
||||
## Best Practices
|
||||
|
||||
1. **Use XML format** for parsing (outfmt 5) - most reliable and complete
|
||||
2. **Save BLAST results** - Don't re-run searches unnecessarily
|
||||
3. **Set appropriate E-value thresholds** - Default is 10, but 0.001-0.01 is often better
|
||||
4. **Handle rate limits** - NCBI limits request frequency
|
||||
5. **Use local BLAST** for large-scale searches or repeated queries
|
||||
6. **Cache results** - Save parsed data to avoid re-parsing
|
||||
7. **Check for empty results** - Handle cases with no hits gracefully
|
||||
8. **Consider alternatives** - For large datasets, consider DIAMOND or other fast aligners
|
||||
9. **Batch searches** - Submit multiple sequences together when possible
|
||||
10. **Filter by identity** - E-value alone may not be sufficient
|
||||
|
||||
## Common Use Cases
|
||||
|
||||
### Basic BLAST Search and Parse
|
||||
|
||||
```python
|
||||
from Bio.Blast import NCBIWWW, NCBIXML
|
||||
from Bio import SeqIO
|
||||
|
||||
# Read query sequence
|
||||
record = SeqIO.read("query.fasta", "fasta")
|
||||
|
||||
# Run BLAST
|
||||
print("Running BLAST search...")
|
||||
result_handle = NCBIWWW.qblast("blastn", "nt", str(record.seq))
|
||||
|
||||
# Parse results
|
||||
blast_record = NCBIXML.read(result_handle)
|
||||
|
||||
# Display top 5 hits
|
||||
print(f"\nTop 5 hits for {blast_record.query}:")
|
||||
for i, alignment in enumerate(blast_record.alignments[:5], 1):
|
||||
hsp = alignment.hsps[0]
|
||||
identity = (hsp.identities / hsp.align_length) * 100
|
||||
print(f"{i}. {alignment.title}")
|
||||
print(f" E-value: {hsp.expect}, Identity: {identity:.1f}%")
|
||||
```
|
||||
|
||||
### Find Orthologs
|
||||
|
||||
```python
|
||||
from Bio.Blast import NCBIWWW, NCBIXML
|
||||
from Bio import Entrez, SeqIO
|
||||
|
||||
Entrez.email = "your.email@example.com"
|
||||
|
||||
# Query gene sequence
|
||||
query_record = SeqIO.read("gene.fasta", "fasta")
|
||||
|
||||
# BLAST against specific organism
|
||||
result_handle = NCBIWWW.qblast(
|
||||
"blastn",
|
||||
"nt",
|
||||
str(query_record.seq),
|
||||
entrez_query="Mus musculus[Organism]" # Restrict to mouse
|
||||
)
|
||||
|
||||
blast_record = NCBIXML.read(result_handle)
|
||||
|
||||
# Find best hit
|
||||
if blast_record.alignments:
|
||||
best_hit = blast_record.alignments[0]
|
||||
print(f"Potential ortholog: {best_hit.title}")
|
||||
print(f"Accession: {best_hit.accession}")
|
||||
```
|
||||
|
||||
### Batch BLAST Multiple Sequences
|
||||
|
||||
```python
|
||||
from Bio.Blast import NCBIWWW, NCBIXML
|
||||
from Bio import SeqIO
|
||||
|
||||
# Read multiple sequences
|
||||
sequences = list(SeqIO.parse("queries.fasta", "fasta"))
|
||||
|
||||
# Create batch results file
|
||||
with open("batch_results.xml", "w") as out_file:
|
||||
for seq_record in sequences:
|
||||
print(f"Searching for {seq_record.id}...")
|
||||
|
||||
result_handle = NCBIWWW.qblast("blastn", "nt", str(seq_record.seq))
|
||||
out_file.write(result_handle.read())
|
||||
result_handle.close()
|
||||
|
||||
# Parse batch results
|
||||
with open("batch_results.xml") as result_handle:
|
||||
for blast_record in NCBIXML.parse(result_handle):
|
||||
print(f"\n{blast_record.query}: {len(blast_record.alignments)} hits")
|
||||
```
|
||||
|
||||
### Reciprocal Best Hits
|
||||
|
||||
```python
|
||||
def reciprocal_best_hit(seq1_id, seq2_id, database="nr", program="blastp"):
|
||||
"""Check if two sequences are reciprocal best hits."""
|
||||
from Bio.Blast import NCBIWWW, NCBIXML
|
||||
from Bio import Entrez
|
||||
|
||||
Entrez.email = "your.email@example.com"
|
||||
|
||||
# Forward BLAST
|
||||
result1 = NCBIWWW.qblast(program, database, seq1_id)
|
||||
record1 = NCBIXML.read(result1)
|
||||
best_hit1 = record1.alignments[0].accession if record1.alignments else None
|
||||
|
||||
# Reverse BLAST
|
||||
result2 = NCBIWWW.qblast(program, database, seq2_id)
|
||||
record2 = NCBIXML.read(result2)
|
||||
best_hit2 = record2.alignments[0].accession if record2.alignments else None
|
||||
|
||||
# Check reciprocity
|
||||
return best_hit1 == seq2_id and best_hit2 == seq1_id
|
||||
```
|
||||
|
||||
## Error Handling
|
||||
|
||||
```python
|
||||
from Bio.Blast import NCBIWWW, NCBIXML
|
||||
from urllib.error import HTTPError
|
||||
|
||||
try:
|
||||
result_handle = NCBIWWW.qblast("blastn", "nt", "ATCGATCGATCG")
|
||||
blast_record = NCBIXML.read(result_handle)
|
||||
result_handle.close()
|
||||
except HTTPError as e:
|
||||
print(f"HTTP Error: {e.code}")
|
||||
except Exception as e:
|
||||
print(f"Error running BLAST: {e}")
|
||||
```
|
||||
484
scientific-skills/biopython/references/databases.md
Normal file
484
scientific-skills/biopython/references/databases.md
Normal file
@@ -0,0 +1,484 @@
|
||||
# Database Access with Bio.Entrez
|
||||
|
||||
## Overview
|
||||
|
||||
Bio.Entrez provides programmatic access to NCBI's Entrez databases, including PubMed, GenBank, Gene, Protein, Nucleotide, and many others. It handles all the complexity of API calls, rate limiting, and data parsing.
|
||||
|
||||
## Setup and Configuration
|
||||
|
||||
### Email Address (Required)
|
||||
|
||||
NCBI requires an email address to track usage and contact users if issues arise:
|
||||
|
||||
```python
|
||||
from Bio import Entrez
|
||||
|
||||
# Always set your email
|
||||
Entrez.email = "your.email@example.com"
|
||||
```
|
||||
|
||||
### API Key (Recommended)
|
||||
|
||||
Using an API key increases rate limits from 3 to 10 requests per second:
|
||||
|
||||
```python
|
||||
# Get API key from: https://www.ncbi.nlm.nih.gov/account/settings/
|
||||
Entrez.api_key = "your_api_key_here"
|
||||
```
|
||||
|
||||
### Rate Limiting
|
||||
|
||||
Biopython automatically respects NCBI rate limits:
|
||||
- **Without API key**: 3 requests per second
|
||||
- **With API key**: 10 requests per second
|
||||
|
||||
The module handles this automatically, so you don't need to add delays between requests.
|
||||
|
||||
## Core Entrez Functions
|
||||
|
||||
### EInfo - Database Information
|
||||
|
||||
Get information about available databases and their statistics:
|
||||
|
||||
```python
|
||||
# List all databases
|
||||
handle = Entrez.einfo()
|
||||
result = Entrez.read(handle)
|
||||
print(result["DbList"])
|
||||
|
||||
# Get information about a specific database
|
||||
handle = Entrez.einfo(db="pubmed")
|
||||
result = Entrez.read(handle)
|
||||
print(result["DbInfo"]["Description"])
|
||||
print(result["DbInfo"]["Count"]) # Number of records
|
||||
```
|
||||
|
||||
### ESearch - Search Databases
|
||||
|
||||
Search for records and retrieve their IDs:
|
||||
|
||||
```python
|
||||
# Search PubMed
|
||||
handle = Entrez.esearch(db="pubmed", term="biopython")
|
||||
result = Entrez.read(handle)
|
||||
handle.close()
|
||||
|
||||
id_list = result["IdList"]
|
||||
count = result["Count"]
|
||||
print(f"Found {count} results")
|
||||
print(f"Retrieved IDs: {id_list}")
|
||||
```
|
||||
|
||||
### Advanced ESearch Parameters
|
||||
|
||||
```python
|
||||
# Search with additional parameters
|
||||
handle = Entrez.esearch(
|
||||
db="pubmed",
|
||||
term="biopython[Title]",
|
||||
retmax=100, # Return up to 100 IDs
|
||||
sort="relevance", # Sort by relevance
|
||||
reldate=365, # Only results from last year
|
||||
datetype="pdat" # Use publication date
|
||||
)
|
||||
result = Entrez.read(handle)
|
||||
handle.close()
|
||||
```
|
||||
|
||||
### ESummary - Get Record Summaries
|
||||
|
||||
Retrieve summary information for a list of IDs:
|
||||
|
||||
```python
|
||||
# Get summaries for multiple records
|
||||
handle = Entrez.esummary(db="pubmed", id="19304878,18606172")
|
||||
results = Entrez.read(handle)
|
||||
handle.close()
|
||||
|
||||
for record in results:
|
||||
print(f"Title: {record['Title']}")
|
||||
print(f"Authors: {record['AuthorList']}")
|
||||
print(f"Journal: {record['Source']}")
|
||||
print()
|
||||
```
|
||||
|
||||
### EFetch - Retrieve Full Records
|
||||
|
||||
Fetch complete records in various formats:
|
||||
|
||||
```python
|
||||
# Fetch a GenBank record
|
||||
handle = Entrez.efetch(db="nucleotide", id="EU490707", rettype="gb", retmode="text")
|
||||
record_text = handle.read()
|
||||
handle.close()
|
||||
|
||||
# Parse with SeqIO
|
||||
from Bio import SeqIO
|
||||
handle = Entrez.efetch(db="nucleotide", id="EU490707", rettype="gb", retmode="text")
|
||||
record = SeqIO.read(handle, "genbank")
|
||||
handle.close()
|
||||
print(record.description)
|
||||
```
|
||||
|
||||
### EFetch Return Types
|
||||
|
||||
Different databases support different return types:
|
||||
|
||||
**Nucleotide/Protein:**
|
||||
- `rettype="fasta"` - FASTA format
|
||||
- `rettype="gb"` or `"genbank"` - GenBank format
|
||||
- `rettype="gp"` - GenPept format (proteins)
|
||||
|
||||
**PubMed:**
|
||||
- `rettype="medline"` - MEDLINE format
|
||||
- `rettype="abstract"` - Abstract text
|
||||
|
||||
**Common modes:**
|
||||
- `retmode="text"` - Plain text
|
||||
- `retmode="xml"` - XML format
|
||||
|
||||
### ELink - Find Related Records
|
||||
|
||||
Find links between records in different databases:
|
||||
|
||||
```python
|
||||
# Find protein records linked to a nucleotide record
|
||||
handle = Entrez.elink(dbfrom="nucleotide", db="protein", id="EU490707")
|
||||
result = Entrez.read(handle)
|
||||
handle.close()
|
||||
|
||||
# Extract linked IDs
|
||||
for linkset in result[0]["LinkSetDb"]:
|
||||
if linkset["LinkName"] == "nucleotide_protein":
|
||||
protein_ids = [link["Id"] for link in linkset["Link"]]
|
||||
print(f"Linked protein IDs: {protein_ids}")
|
||||
```
|
||||
|
||||
### EPost - Upload ID Lists
|
||||
|
||||
Upload large lists of IDs to the server for later use:
|
||||
|
||||
```python
|
||||
# Post IDs to server
|
||||
id_list = ["19304878", "18606172", "16403221"]
|
||||
handle = Entrez.epost(db="pubmed", id=",".join(id_list))
|
||||
result = Entrez.read(handle)
|
||||
handle.close()
|
||||
|
||||
# Get query_key and WebEnv for later use
|
||||
query_key = result["QueryKey"]
|
||||
webenv = result["WebEnv"]
|
||||
|
||||
# Use in subsequent queries
|
||||
handle = Entrez.efetch(
|
||||
db="pubmed",
|
||||
query_key=query_key,
|
||||
WebEnv=webenv,
|
||||
rettype="medline",
|
||||
retmode="text"
|
||||
)
|
||||
```
|
||||
|
||||
### EGQuery - Global Query
|
||||
|
||||
Search across all Entrez databases at once:
|
||||
|
||||
```python
|
||||
handle = Entrez.egquery(term="biopython")
|
||||
result = Entrez.read(handle)
|
||||
handle.close()
|
||||
|
||||
for row in result["eGQueryResult"]:
|
||||
print(f"{row['DbName']}: {row['Count']} results")
|
||||
```
|
||||
|
||||
### ESpell - Spelling Suggestions
|
||||
|
||||
Get spelling suggestions for search terms:
|
||||
|
||||
```python
|
||||
handle = Entrez.espell(db="pubmed", term="biopythn")
|
||||
result = Entrez.read(handle)
|
||||
handle.close()
|
||||
|
||||
print(f"Original: {result['Query']}")
|
||||
print(f"Suggestion: {result['CorrectedQuery']}")
|
||||
```
|
||||
|
||||
## Working with Different Databases
|
||||
|
||||
### PubMed
|
||||
|
||||
```python
|
||||
# Search for articles
|
||||
handle = Entrez.esearch(db="pubmed", term="cancer genomics", retmax=10)
|
||||
result = Entrez.read(handle)
|
||||
handle.close()
|
||||
|
||||
# Fetch abstracts
|
||||
handle = Entrez.efetch(
|
||||
db="pubmed",
|
||||
id=result["IdList"],
|
||||
rettype="medline",
|
||||
retmode="text"
|
||||
)
|
||||
records = handle.read()
|
||||
handle.close()
|
||||
print(records)
|
||||
```
|
||||
|
||||
### GenBank / Nucleotide
|
||||
|
||||
```python
|
||||
# Search for sequences
|
||||
handle = Entrez.esearch(db="nucleotide", term="Cypripedioideae[Orgn] AND matK[Gene]")
|
||||
result = Entrez.read(handle)
|
||||
handle.close()
|
||||
|
||||
# Fetch sequences
|
||||
if result["IdList"]:
|
||||
handle = Entrez.efetch(
|
||||
db="nucleotide",
|
||||
id=result["IdList"][:5],
|
||||
rettype="fasta",
|
||||
retmode="text"
|
||||
)
|
||||
sequences = handle.read()
|
||||
handle.close()
|
||||
```
|
||||
|
||||
### Protein
|
||||
|
||||
```python
|
||||
# Search for protein sequences
|
||||
handle = Entrez.esearch(db="protein", term="human insulin")
|
||||
result = Entrez.read(handle)
|
||||
handle.close()
|
||||
|
||||
# Fetch protein records
|
||||
from Bio import SeqIO
|
||||
handle = Entrez.efetch(
|
||||
db="protein",
|
||||
id=result["IdList"][:5],
|
||||
rettype="gp",
|
||||
retmode="text"
|
||||
)
|
||||
records = SeqIO.parse(handle, "genbank")
|
||||
for record in records:
|
||||
print(f"{record.id}: {record.description}")
|
||||
handle.close()
|
||||
```
|
||||
|
||||
### Gene
|
||||
|
||||
```python
|
||||
# Search for gene records
|
||||
handle = Entrez.esearch(db="gene", term="BRCA1[Gene] AND human[Organism]")
|
||||
result = Entrez.read(handle)
|
||||
handle.close()
|
||||
|
||||
# Get gene information
|
||||
handle = Entrez.efetch(db="gene", id=result["IdList"][0], retmode="xml")
|
||||
record = Entrez.read(handle)
|
||||
handle.close()
|
||||
```
|
||||
|
||||
### Taxonomy
|
||||
|
||||
```python
|
||||
# Search for organism
|
||||
handle = Entrez.esearch(db="taxonomy", term="Homo sapiens")
|
||||
result = Entrez.read(handle)
|
||||
handle.close()
|
||||
|
||||
# Fetch taxonomic information
|
||||
handle = Entrez.efetch(db="taxonomy", id=result["IdList"][0], retmode="xml")
|
||||
records = Entrez.read(handle)
|
||||
handle.close()
|
||||
|
||||
for record in records:
|
||||
print(f"TaxID: {record['TaxId']}")
|
||||
print(f"Scientific Name: {record['ScientificName']}")
|
||||
print(f"Lineage: {record['Lineage']}")
|
||||
```
|
||||
|
||||
## Parsing Entrez Results
|
||||
|
||||
### Reading XML Results
|
||||
|
||||
```python
|
||||
# Most results can be parsed with Entrez.read()
|
||||
handle = Entrez.efetch(db="pubmed", id="19304878", retmode="xml")
|
||||
records = Entrez.read(handle)
|
||||
handle.close()
|
||||
|
||||
# Access parsed data
|
||||
article = records['PubmedArticle'][0]['MedlineCitation']['Article']
|
||||
print(article['ArticleTitle'])
|
||||
```
|
||||
|
||||
### Handling Large Result Sets
|
||||
|
||||
```python
|
||||
# Batch processing for large searches
|
||||
search_term = "cancer[Title]"
|
||||
handle = Entrez.esearch(db="pubmed", term=search_term, retmax=0)
|
||||
result = Entrez.read(handle)
|
||||
handle.close()
|
||||
|
||||
total_count = int(result["Count"])
|
||||
batch_size = 500
|
||||
|
||||
for start in range(0, total_count, batch_size):
|
||||
# Fetch batch
|
||||
handle = Entrez.esearch(
|
||||
db="pubmed",
|
||||
term=search_term,
|
||||
retstart=start,
|
||||
retmax=batch_size
|
||||
)
|
||||
result = Entrez.read(handle)
|
||||
handle.close()
|
||||
|
||||
# Process IDs
|
||||
id_list = result["IdList"]
|
||||
print(f"Processing IDs {start} to {start + len(id_list)}")
|
||||
```
|
||||
|
||||
## Advanced Patterns
|
||||
|
||||
### Search History with WebEnv
|
||||
|
||||
```python
|
||||
# Perform search and store on server
|
||||
handle = Entrez.esearch(
|
||||
db="pubmed",
|
||||
term="biopython",
|
||||
usehistory="y"
|
||||
)
|
||||
result = Entrez.read(handle)
|
||||
handle.close()
|
||||
|
||||
webenv = result["WebEnv"]
|
||||
query_key = result["QueryKey"]
|
||||
count = int(result["Count"])
|
||||
|
||||
# Fetch results in batches using history
|
||||
batch_size = 100
|
||||
for start in range(0, count, batch_size):
|
||||
handle = Entrez.efetch(
|
||||
db="pubmed",
|
||||
retstart=start,
|
||||
retmax=batch_size,
|
||||
rettype="medline",
|
||||
retmode="text",
|
||||
webenv=webenv,
|
||||
query_key=query_key
|
||||
)
|
||||
data = handle.read()
|
||||
handle.close()
|
||||
# Process data
|
||||
```
|
||||
|
||||
### Combining Searches
|
||||
|
||||
```python
|
||||
# Use boolean operators
|
||||
complex_search = "(cancer[Title]) AND (genomics[Title]) AND 2020:2025[PDAT]"
|
||||
handle = Entrez.esearch(db="pubmed", term=complex_search, retmax=100)
|
||||
result = Entrez.read(handle)
|
||||
handle.close()
|
||||
```
|
||||
|
||||
## Best Practices
|
||||
|
||||
1. **Always set Entrez.email** - Required by NCBI
|
||||
2. **Use API key** for higher rate limits (10 req/s vs 3 req/s)
|
||||
3. **Close handles** after reading to free resources
|
||||
4. **Batch large requests** - Use retstart and retmax for pagination
|
||||
5. **Use WebEnv for large downloads** - Store results on server
|
||||
6. **Cache locally** - Download once and save to avoid repeated requests
|
||||
7. **Handle errors gracefully** - Network issues and API limits can occur
|
||||
8. **Respect NCBI guidelines** - Don't overwhelm the service
|
||||
9. **Use appropriate rettype** - Choose format that matches your needs
|
||||
10. **Parse XML carefully** - Structure varies by database and record type
|
||||
|
||||
## Error Handling
|
||||
|
||||
```python
|
||||
from urllib.error import HTTPError
|
||||
from Bio import Entrez
|
||||
|
||||
Entrez.email = "your.email@example.com"
|
||||
|
||||
try:
|
||||
handle = Entrez.efetch(db="nucleotide", id="invalid_id", rettype="gb")
|
||||
record = handle.read()
|
||||
handle.close()
|
||||
except HTTPError as e:
|
||||
print(f"HTTP Error: {e.code} - {e.reason}")
|
||||
except Exception as e:
|
||||
print(f"Error: {e}")
|
||||
```
|
||||
|
||||
## Common Use Cases
|
||||
|
||||
### Download GenBank Records
|
||||
|
||||
```python
|
||||
from Bio import Entrez, SeqIO
|
||||
|
||||
Entrez.email = "your.email@example.com"
|
||||
|
||||
# List of accession numbers
|
||||
accessions = ["EU490707", "EU490708", "EU490709"]
|
||||
|
||||
for acc in accessions:
|
||||
handle = Entrez.efetch(db="nucleotide", id=acc, rettype="gb", retmode="text")
|
||||
record = SeqIO.read(handle, "genbank")
|
||||
handle.close()
|
||||
|
||||
# Save to file
|
||||
SeqIO.write(record, f"{acc}.gb", "genbank")
|
||||
```
|
||||
|
||||
### Search and Download Papers
|
||||
|
||||
```python
|
||||
# Search PubMed
|
||||
handle = Entrez.esearch(db="pubmed", term="machine learning bioinformatics", retmax=20)
|
||||
result = Entrez.read(handle)
|
||||
handle.close()
|
||||
|
||||
# Get details
|
||||
handle = Entrez.efetch(db="pubmed", id=result["IdList"], retmode="xml")
|
||||
papers = Entrez.read(handle)
|
||||
handle.close()
|
||||
|
||||
# Extract information
|
||||
for paper in papers['PubmedArticle']:
|
||||
article = paper['MedlineCitation']['Article']
|
||||
print(f"Title: {article['ArticleTitle']}")
|
||||
print(f"Journal: {article['Journal']['Title']}")
|
||||
print()
|
||||
```
|
||||
|
||||
### Find Related Sequences
|
||||
|
||||
```python
|
||||
# Start with one sequence
|
||||
handle = Entrez.efetch(db="nucleotide", id="EU490707", rettype="gb", retmode="text")
|
||||
record = SeqIO.read(handle, "genbank")
|
||||
handle.close()
|
||||
|
||||
# Find similar sequences
|
||||
handle = Entrez.elink(dbfrom="nucleotide", db="nucleotide", id="EU490707")
|
||||
result = Entrez.read(handle)
|
||||
handle.close()
|
||||
|
||||
# Get related IDs
|
||||
related_ids = []
|
||||
for linkset in result[0]["LinkSetDb"]:
|
||||
for link in linkset["Link"]:
|
||||
related_ids.append(link["Id"])
|
||||
```
|
||||
566
scientific-skills/biopython/references/phylogenetics.md
Normal file
566
scientific-skills/biopython/references/phylogenetics.md
Normal file
@@ -0,0 +1,566 @@
|
||||
# Phylogenetics with Bio.Phylo
|
||||
|
||||
## Overview
|
||||
|
||||
Bio.Phylo provides a unified toolkit for reading, writing, analyzing, and visualizing phylogenetic trees. It supports multiple file formats including Newick, NEXUS, phyloXML, NeXML, and CDAO.
|
||||
|
||||
## Supported File Formats
|
||||
|
||||
- **Newick** - Simple tree representation (most common)
|
||||
- **NEXUS** - Extended format with additional data
|
||||
- **phyloXML** - XML-based format with rich annotations
|
||||
- **NeXML** - Modern XML format
|
||||
- **CDAO** - Comparative Data Analysis Ontology
|
||||
|
||||
## Reading and Writing Trees
|
||||
|
||||
### Reading Trees
|
||||
|
||||
```python
|
||||
from Bio import Phylo
|
||||
|
||||
# Read a tree from file
|
||||
tree = Phylo.read("tree.nwk", "newick")
|
||||
|
||||
# Parse multiple trees from a file
|
||||
trees = list(Phylo.parse("trees.nwk", "newick"))
|
||||
print(f"Found {len(trees)} trees")
|
||||
```
|
||||
|
||||
### Writing Trees
|
||||
|
||||
```python
|
||||
# Write tree to file
|
||||
Phylo.write(tree, "output.nwk", "newick")
|
||||
|
||||
# Write multiple trees
|
||||
Phylo.write(trees, "output.nex", "nexus")
|
||||
```
|
||||
|
||||
### Format Conversion
|
||||
|
||||
```python
|
||||
# Convert between formats
|
||||
count = Phylo.convert("input.nwk", "newick", "output.xml", "phyloxml")
|
||||
print(f"Converted {count} trees")
|
||||
```
|
||||
|
||||
## Tree Structure and Navigation
|
||||
|
||||
### Basic Tree Components
|
||||
|
||||
Trees consist of:
|
||||
- **Clade** - A node (internal or terminal) in the tree
|
||||
- **Terminal clades** - Leaves/tips (taxa)
|
||||
- **Internal clades** - Internal nodes
|
||||
- **Branch length** - Evolutionary distance
|
||||
|
||||
### Accessing Tree Properties
|
||||
|
||||
```python
|
||||
# Tree root
|
||||
root = tree.root
|
||||
|
||||
# Terminal nodes (leaves)
|
||||
terminals = tree.get_terminals()
|
||||
print(f"Number of taxa: {len(terminals)}")
|
||||
|
||||
# Non-terminal nodes
|
||||
nonterminals = tree.get_nonterminals()
|
||||
print(f"Number of internal nodes: {len(nonterminals)}")
|
||||
|
||||
# All clades
|
||||
all_clades = list(tree.find_clades())
|
||||
print(f"Total clades: {len(all_clades)}")
|
||||
```
|
||||
|
||||
### Traversing Trees
|
||||
|
||||
```python
|
||||
# Iterate through all clades
|
||||
for clade in tree.find_clades():
|
||||
if clade.name:
|
||||
print(f"Clade: {clade.name}, Branch length: {clade.branch_length}")
|
||||
|
||||
# Iterate through terminals only
|
||||
for terminal in tree.get_terminals():
|
||||
print(f"Taxon: {terminal.name}")
|
||||
|
||||
# Depth-first traversal
|
||||
for clade in tree.find_clades(order="preorder"):
|
||||
print(clade.name)
|
||||
|
||||
# Level-order (breadth-first) traversal
|
||||
for clade in tree.find_clades(order="level"):
|
||||
print(clade.name)
|
||||
```
|
||||
|
||||
### Finding Specific Clades
|
||||
|
||||
```python
|
||||
# Find clade by name
|
||||
clade = tree.find_any(name="Species_A")
|
||||
|
||||
# Find all clades matching criteria
|
||||
def is_long_branch(clade):
|
||||
return clade.branch_length and clade.branch_length > 0.5
|
||||
|
||||
long_branches = tree.find_clades(is_long_branch)
|
||||
```
|
||||
|
||||
## Tree Analysis
|
||||
|
||||
### Tree Statistics
|
||||
|
||||
```python
|
||||
# Total branch length
|
||||
total_length = tree.total_branch_length()
|
||||
print(f"Total tree length: {total_length:.3f}")
|
||||
|
||||
# Tree depth (root to furthest leaf)
|
||||
depths = tree.depths()
|
||||
max_depth = max(depths.values())
|
||||
print(f"Maximum depth: {max_depth:.3f}")
|
||||
|
||||
# Terminal count
|
||||
terminal_count = tree.count_terminals()
|
||||
print(f"Number of taxa: {terminal_count}")
|
||||
```
|
||||
|
||||
### Distance Calculations
|
||||
|
||||
```python
|
||||
# Distance between two taxa
|
||||
distance = tree.distance("Species_A", "Species_B")
|
||||
print(f"Distance: {distance:.3f}")
|
||||
|
||||
# Create distance matrix
|
||||
from Bio import Phylo
|
||||
|
||||
terminals = tree.get_terminals()
|
||||
taxa_names = [t.name for t in terminals]
|
||||
|
||||
print("Distance Matrix:")
|
||||
for taxon1 in taxa_names:
|
||||
row = []
|
||||
for taxon2 in taxa_names:
|
||||
if taxon1 == taxon2:
|
||||
row.append(0)
|
||||
else:
|
||||
dist = tree.distance(taxon1, taxon2)
|
||||
row.append(dist)
|
||||
print(f"{taxon1}: {row}")
|
||||
```
|
||||
|
||||
### Common Ancestors
|
||||
|
||||
```python
|
||||
# Find common ancestor of two clades
|
||||
clade1 = tree.find_any(name="Species_A")
|
||||
clade2 = tree.find_any(name="Species_B")
|
||||
ancestor = tree.common_ancestor(clade1, clade2)
|
||||
print(f"Common ancestor: {ancestor.name}")
|
||||
|
||||
# Find common ancestor of multiple clades
|
||||
clades = [tree.find_any(name=n) for n in ["Species_A", "Species_B", "Species_C"]]
|
||||
ancestor = tree.common_ancestor(*clades)
|
||||
```
|
||||
|
||||
### Tree Comparison
|
||||
|
||||
```python
|
||||
# Compare tree topologies
|
||||
def compare_trees(tree1, tree2):
|
||||
"""Compare two trees."""
|
||||
# Get terminal names
|
||||
taxa1 = set(t.name for t in tree1.get_terminals())
|
||||
taxa2 = set(t.name for t in tree2.get_terminals())
|
||||
|
||||
# Check if they have same taxa
|
||||
if taxa1 != taxa2:
|
||||
return False, "Different taxa"
|
||||
|
||||
# Compare distances
|
||||
differences = []
|
||||
for taxon1 in taxa1:
|
||||
for taxon2 in taxa1:
|
||||
if taxon1 < taxon2:
|
||||
dist1 = tree1.distance(taxon1, taxon2)
|
||||
dist2 = tree2.distance(taxon1, taxon2)
|
||||
if abs(dist1 - dist2) > 0.01:
|
||||
differences.append((taxon1, taxon2, dist1, dist2))
|
||||
|
||||
return len(differences) == 0, differences
|
||||
```
|
||||
|
||||
## Tree Manipulation
|
||||
|
||||
### Pruning Trees
|
||||
|
||||
```python
|
||||
# Prune (remove) specific taxa
|
||||
tree_copy = tree.copy()
|
||||
tree_copy.prune("Species_A")
|
||||
|
||||
# Keep only specific taxa
|
||||
taxa_to_keep = ["Species_B", "Species_C", "Species_D"]
|
||||
terminals = tree_copy.get_terminals()
|
||||
for terminal in terminals:
|
||||
if terminal.name not in taxa_to_keep:
|
||||
tree_copy.prune(terminal)
|
||||
```
|
||||
|
||||
### Collapsing Short Branches
|
||||
|
||||
```python
|
||||
# Collapse branches shorter than threshold
|
||||
def collapse_short_branches(tree, threshold=0.01):
|
||||
"""Collapse branches shorter than threshold."""
|
||||
for clade in tree.find_clades():
|
||||
if clade.branch_length and clade.branch_length < threshold:
|
||||
clade.branch_length = 0
|
||||
return tree
|
||||
```
|
||||
|
||||
### Ladderizing Trees
|
||||
|
||||
```python
|
||||
# Ladderize tree (sort branches by size)
|
||||
tree.ladderize() # ascending order
|
||||
tree.ladderize(reverse=True) # descending order
|
||||
```
|
||||
|
||||
### Rerooting Trees
|
||||
|
||||
```python
|
||||
# Reroot at midpoint
|
||||
tree.root_at_midpoint()
|
||||
|
||||
# Reroot with outgroup
|
||||
outgroup = tree.find_any(name="Outgroup_Species")
|
||||
tree.root_with_outgroup(outgroup)
|
||||
|
||||
# Reroot at internal node
|
||||
internal = tree.get_nonterminals()[0]
|
||||
tree.root_with_outgroup(internal)
|
||||
```
|
||||
|
||||
## Tree Visualization
|
||||
|
||||
### Basic ASCII Drawing
|
||||
|
||||
```python
|
||||
# Draw tree to console
|
||||
Phylo.draw_ascii(tree)
|
||||
|
||||
# Draw with custom format
|
||||
Phylo.draw_ascii(tree, column_width=80)
|
||||
```
|
||||
|
||||
### Matplotlib Visualization
|
||||
|
||||
```python
|
||||
import matplotlib.pyplot as plt
|
||||
from Bio import Phylo
|
||||
|
||||
# Simple plot
|
||||
fig = plt.figure(figsize=(10, 8))
|
||||
axes = fig.add_subplot(1, 1, 1)
|
||||
Phylo.draw(tree, axes=axes)
|
||||
plt.show()
|
||||
|
||||
# Customize plot
|
||||
fig = plt.figure(figsize=(10, 8))
|
||||
axes = fig.add_subplot(1, 1, 1)
|
||||
Phylo.draw(tree, axes=axes, do_show=False)
|
||||
axes.set_title("Phylogenetic Tree")
|
||||
plt.tight_layout()
|
||||
plt.savefig("tree.png", dpi=300)
|
||||
```
|
||||
|
||||
### Advanced Visualization Options
|
||||
|
||||
```python
|
||||
# Radial (circular) tree
|
||||
Phylo.draw(tree, branch_labels=lambda c: c.branch_length)
|
||||
|
||||
# Show branch support values
|
||||
Phylo.draw(tree, label_func=lambda n: str(n.confidence) if n.confidence else "")
|
||||
|
||||
# Color branches
|
||||
def color_by_length(clade):
|
||||
if clade.branch_length:
|
||||
if clade.branch_length > 0.5:
|
||||
return "red"
|
||||
elif clade.branch_length > 0.2:
|
||||
return "orange"
|
||||
return "black"
|
||||
|
||||
# Note: Direct branch coloring requires custom matplotlib code
|
||||
```
|
||||
|
||||
## Building Trees
|
||||
|
||||
### From Distance Matrix
|
||||
|
||||
```python
|
||||
from Bio.Phylo.TreeConstruction import DistanceTreeConstructor, DistanceMatrix
|
||||
|
||||
# Create distance matrix
|
||||
dm = DistanceMatrix(
|
||||
names=["Alpha", "Beta", "Gamma", "Delta"],
|
||||
matrix=[
|
||||
[],
|
||||
[0.23],
|
||||
[0.45, 0.34],
|
||||
[0.67, 0.58, 0.29]
|
||||
]
|
||||
)
|
||||
|
||||
# Build tree using UPGMA
|
||||
constructor = DistanceTreeConstructor()
|
||||
tree = constructor.upgma(dm)
|
||||
Phylo.draw_ascii(tree)
|
||||
|
||||
# Build tree using Neighbor-Joining
|
||||
tree = constructor.nj(dm)
|
||||
```
|
||||
|
||||
### From Multiple Sequence Alignment
|
||||
|
||||
```python
|
||||
from Bio import AlignIO, Phylo
|
||||
from Bio.Phylo.TreeConstruction import DistanceCalculator, DistanceTreeConstructor
|
||||
|
||||
# Read alignment
|
||||
alignment = AlignIO.read("alignment.fasta", "fasta")
|
||||
|
||||
# Calculate distance matrix
|
||||
calculator = DistanceCalculator("identity")
|
||||
distance_matrix = calculator.get_distance(alignment)
|
||||
|
||||
# Build tree
|
||||
constructor = DistanceTreeConstructor()
|
||||
tree = constructor.upgma(distance_matrix)
|
||||
|
||||
# Write tree
|
||||
Phylo.write(tree, "output_tree.nwk", "newick")
|
||||
```
|
||||
|
||||
### Distance Models
|
||||
|
||||
Available distance calculation models:
|
||||
- **identity** - Simple identity
|
||||
- **blastn** - BLASTN identity
|
||||
- **trans** - Transition/transversion ratio
|
||||
- **blosum62** - BLOSUM62 matrix
|
||||
- **pam250** - PAM250 matrix
|
||||
|
||||
```python
|
||||
# Use different model
|
||||
calculator = DistanceCalculator("blosum62")
|
||||
dm = calculator.get_distance(alignment)
|
||||
```
|
||||
|
||||
## Consensus Trees
|
||||
|
||||
```python
|
||||
from Bio.Phylo.Consensus import majority_consensus, strict_consensus
|
||||
|
||||
# Read multiple trees
|
||||
trees = list(Phylo.parse("bootstrap_trees.nwk", "newick"))
|
||||
|
||||
# Majority-rule consensus
|
||||
consensus = majority_consensus(trees, cutoff=0.5)
|
||||
|
||||
# Strict consensus
|
||||
strict_cons = strict_consensus(trees)
|
||||
|
||||
# Write consensus tree
|
||||
Phylo.write(consensus, "consensus.nwk", "newick")
|
||||
```
|
||||
|
||||
## PhyloXML Features
|
||||
|
||||
PhyloXML format supports rich annotations:
|
||||
|
||||
```python
|
||||
from Bio.Phylo.PhyloXML import Phylogeny, Clade
|
||||
|
||||
# Create PhyloXML tree
|
||||
tree = Phylogeny(rooted=True)
|
||||
tree.name = "Example Tree"
|
||||
tree.description = "A sample phylogenetic tree"
|
||||
|
||||
# Add clades with rich annotations
|
||||
clade = Clade(branch_length=0.5)
|
||||
clade.name = "Species_A"
|
||||
clade.color = "red"
|
||||
clade.width = 2.0
|
||||
|
||||
# Add taxonomy information
|
||||
from Bio.Phylo.PhyloXML import Taxonomy
|
||||
taxonomy = Taxonomy(scientific_name="Homo sapiens", common_name="Human")
|
||||
clade.taxonomies.append(taxonomy)
|
||||
```
|
||||
|
||||
## Bootstrap Support
|
||||
|
||||
```python
|
||||
# Add bootstrap support values to tree
|
||||
def add_bootstrap_support(tree, support_values):
|
||||
"""Add bootstrap support to internal nodes."""
|
||||
internal_nodes = tree.get_nonterminals()
|
||||
for node, support in zip(internal_nodes, support_values):
|
||||
node.confidence = support
|
||||
return tree
|
||||
|
||||
# Example
|
||||
support_values = [95, 87, 76, 92]
|
||||
tree_with_support = add_bootstrap_support(tree, support_values)
|
||||
```
|
||||
|
||||
## Best Practices
|
||||
|
||||
1. **Choose appropriate file format** - Newick for simple trees, phyloXML for annotations
|
||||
2. **Validate tree topology** - Check for polytomies and negative branch lengths
|
||||
3. **Root trees appropriately** - Use midpoint or outgroup rooting
|
||||
4. **Handle bootstrap values** - Store as clade confidence
|
||||
5. **Consider tree size** - Large trees may need special handling
|
||||
6. **Use tree copies** - Call `.copy()` before modifications
|
||||
7. **Export publication-ready figures** - Use matplotlib for high-quality output
|
||||
8. **Document tree construction** - Record alignment and parameters used
|
||||
9. **Compare multiple trees** - Use consensus methods for bootstrap trees
|
||||
10. **Validate taxon names** - Ensure consistent naming across files
|
||||
|
||||
## Common Use Cases
|
||||
|
||||
### Build Tree from Sequences
|
||||
|
||||
```python
|
||||
from Bio import AlignIO, Phylo
|
||||
from Bio.Phylo.TreeConstruction import DistanceCalculator, DistanceTreeConstructor
|
||||
|
||||
# Read aligned sequences
|
||||
alignment = AlignIO.read("sequences.aln", "clustal")
|
||||
|
||||
# Calculate distances
|
||||
calculator = DistanceCalculator("identity")
|
||||
dm = calculator.get_distance(alignment)
|
||||
|
||||
# Build neighbor-joining tree
|
||||
constructor = DistanceTreeConstructor()
|
||||
tree = constructor.nj(dm)
|
||||
|
||||
# Root at midpoint
|
||||
tree.root_at_midpoint()
|
||||
|
||||
# Save tree
|
||||
Phylo.write(tree, "tree.nwk", "newick")
|
||||
|
||||
# Visualize
|
||||
import matplotlib.pyplot as plt
|
||||
fig = plt.figure(figsize=(10, 8))
|
||||
Phylo.draw(tree)
|
||||
plt.show()
|
||||
```
|
||||
|
||||
### Extract Subtree
|
||||
|
||||
```python
|
||||
def extract_subtree(tree, taxa_list):
|
||||
"""Extract subtree containing specific taxa."""
|
||||
# Create a copy
|
||||
subtree = tree.copy()
|
||||
|
||||
# Get all terminals
|
||||
all_terminals = subtree.get_terminals()
|
||||
|
||||
# Prune taxa not in list
|
||||
for terminal in all_terminals:
|
||||
if terminal.name not in taxa_list:
|
||||
subtree.prune(terminal)
|
||||
|
||||
return subtree
|
||||
|
||||
# Use it
|
||||
subtree = extract_subtree(tree, ["Species_A", "Species_B", "Species_C"])
|
||||
Phylo.write(subtree, "subtree.nwk", "newick")
|
||||
```
|
||||
|
||||
### Calculate Phylogenetic Diversity
|
||||
|
||||
```python
|
||||
def phylogenetic_diversity(tree, taxa_subset=None):
|
||||
"""Calculate phylogenetic diversity (sum of branch lengths)."""
|
||||
if taxa_subset:
|
||||
# Prune to subset
|
||||
tree = extract_subtree(tree, taxa_subset)
|
||||
|
||||
# Sum all branch lengths
|
||||
total = 0
|
||||
for clade in tree.find_clades():
|
||||
if clade.branch_length:
|
||||
total += clade.branch_length
|
||||
|
||||
return total
|
||||
|
||||
# Calculate PD for all taxa
|
||||
pd_all = phylogenetic_diversity(tree)
|
||||
print(f"Total phylogenetic diversity: {pd_all:.3f}")
|
||||
|
||||
# Calculate PD for subset
|
||||
pd_subset = phylogenetic_diversity(tree, ["Species_A", "Species_B"])
|
||||
print(f"Subset phylogenetic diversity: {pd_subset:.3f}")
|
||||
```
|
||||
|
||||
### Annotate Tree with External Data
|
||||
|
||||
```python
|
||||
def annotate_tree_from_csv(tree, csv_file):
|
||||
"""Annotate tree leaves with data from CSV."""
|
||||
import csv
|
||||
|
||||
# Read annotation data
|
||||
annotations = {}
|
||||
with open(csv_file) as f:
|
||||
reader = csv.DictReader(f)
|
||||
for row in reader:
|
||||
annotations[row["species"]] = row
|
||||
|
||||
# Annotate tree
|
||||
for terminal in tree.get_terminals():
|
||||
if terminal.name in annotations:
|
||||
# Add custom attributes
|
||||
for key, value in annotations[terminal.name].items():
|
||||
setattr(terminal, key, value)
|
||||
|
||||
return tree
|
||||
```
|
||||
|
||||
### Compare Tree Topologies
|
||||
|
||||
```python
|
||||
def robinson_foulds_distance(tree1, tree2):
|
||||
"""Calculate Robinson-Foulds distance between two trees."""
|
||||
# Get bipartitions for each tree
|
||||
def get_bipartitions(tree):
|
||||
bipartitions = set()
|
||||
for clade in tree.get_nonterminals():
|
||||
terminals = frozenset(t.name for t in clade.get_terminals())
|
||||
bipartitions.add(terminals)
|
||||
return bipartitions
|
||||
|
||||
bp1 = get_bipartitions(tree1)
|
||||
bp2 = get_bipartitions(tree2)
|
||||
|
||||
# Symmetric difference
|
||||
diff = len(bp1.symmetric_difference(bp2))
|
||||
return diff
|
||||
|
||||
# Use it
|
||||
tree1 = Phylo.read("tree1.nwk", "newick")
|
||||
tree2 = Phylo.read("tree2.nwk", "newick")
|
||||
rf_dist = robinson_foulds_distance(tree1, tree2)
|
||||
print(f"Robinson-Foulds distance: {rf_dist}")
|
||||
```
|
||||
285
scientific-skills/biopython/references/sequence_io.md
Normal file
285
scientific-skills/biopython/references/sequence_io.md
Normal file
@@ -0,0 +1,285 @@
|
||||
# Sequence Handling with Bio.Seq and Bio.SeqIO
|
||||
|
||||
## Overview
|
||||
|
||||
Bio.Seq provides the `Seq` object for biological sequences with specialized methods, while Bio.SeqIO offers a unified interface for reading, writing, and converting sequence files across multiple formats.
|
||||
|
||||
## The Seq Object
|
||||
|
||||
### Creating Sequences
|
||||
|
||||
```python
|
||||
from Bio.Seq import Seq
|
||||
|
||||
# Create a basic sequence
|
||||
my_seq = Seq("AGTACACTGGT")
|
||||
|
||||
# Sequences support string-like operations
|
||||
print(len(my_seq)) # Length
|
||||
print(my_seq[0:5]) # Slicing
|
||||
```
|
||||
|
||||
### Core Sequence Operations
|
||||
|
||||
```python
|
||||
# Complement and reverse complement
|
||||
complement = my_seq.complement()
|
||||
rev_comp = my_seq.reverse_complement()
|
||||
|
||||
# Transcription (DNA to RNA)
|
||||
rna = my_seq.transcribe()
|
||||
|
||||
# Translation (to protein)
|
||||
protein = my_seq.translate()
|
||||
|
||||
# Back-transcription (RNA to DNA)
|
||||
dna = rna_seq.back_transcribe()
|
||||
```
|
||||
|
||||
### Sequence Methods
|
||||
|
||||
- `complement()` - Returns complementary strand
|
||||
- `reverse_complement()` - Returns reverse complement
|
||||
- `transcribe()` - DNA to RNA transcription
|
||||
- `back_transcribe()` - RNA to DNA conversion
|
||||
- `translate()` - Translate to protein sequence
|
||||
- `translate(table=N)` - Use specific genetic code table
|
||||
- `translate(to_stop=True)` - Stop at first stop codon
|
||||
|
||||
## Bio.SeqIO: Sequence File I/O
|
||||
|
||||
### Core Functions
|
||||
|
||||
**Bio.SeqIO.parse()**: The primary workhorse for reading sequence files as an iterator of `SeqRecord` objects.
|
||||
|
||||
```python
|
||||
from Bio import SeqIO
|
||||
|
||||
# Parse a FASTA file
|
||||
for record in SeqIO.parse("sequences.fasta", "fasta"):
|
||||
print(record.id)
|
||||
print(record.seq)
|
||||
print(len(record))
|
||||
```
|
||||
|
||||
**Bio.SeqIO.read()**: For single-record files (validates exactly one record exists).
|
||||
|
||||
```python
|
||||
record = SeqIO.read("single.fasta", "fasta")
|
||||
```
|
||||
|
||||
**Bio.SeqIO.write()**: Output SeqRecord objects to files.
|
||||
|
||||
```python
|
||||
# Write records to file
|
||||
count = SeqIO.write(seq_records, "output.fasta", "fasta")
|
||||
print(f"Wrote {count} records")
|
||||
```
|
||||
|
||||
**Bio.SeqIO.convert()**: Streamlined format conversion.
|
||||
|
||||
```python
|
||||
# Convert between formats
|
||||
count = SeqIO.convert("input.gbk", "genbank", "output.fasta", "fasta")
|
||||
```
|
||||
|
||||
### Supported File Formats
|
||||
|
||||
Common formats include:
|
||||
- **fasta** - FASTA format
|
||||
- **fastq** - FASTQ format (with quality scores)
|
||||
- **genbank** or **gb** - GenBank format
|
||||
- **embl** - EMBL format
|
||||
- **swiss** - SwissProt format
|
||||
- **fasta-2line** - FASTA with sequence on one line
|
||||
- **tab** - Simple tab-separated format
|
||||
|
||||
### The SeqRecord Object
|
||||
|
||||
`SeqRecord` objects combine sequence data with annotations:
|
||||
|
||||
```python
|
||||
record.id # Primary identifier
|
||||
record.name # Short name
|
||||
record.description # Description line
|
||||
record.seq # The actual sequence (Seq object)
|
||||
record.annotations # Dictionary of additional info
|
||||
record.features # List of SeqFeature objects
|
||||
record.letter_annotations # Per-letter annotations (e.g., quality scores)
|
||||
```
|
||||
|
||||
### Modifying Records
|
||||
|
||||
```python
|
||||
# Modify record attributes
|
||||
record.id = "new_id"
|
||||
record.description = "New description"
|
||||
|
||||
# Extract subsequences
|
||||
sub_record = record[10:30] # Slicing preserves annotations
|
||||
|
||||
# Modify sequence
|
||||
record.seq = record.seq.reverse_complement()
|
||||
```
|
||||
|
||||
## Working with Large Files
|
||||
|
||||
### Memory-Efficient Parsing
|
||||
|
||||
Use iterators to avoid loading entire files into memory:
|
||||
|
||||
```python
|
||||
# Good for large files
|
||||
for record in SeqIO.parse("large_file.fasta", "fasta"):
|
||||
if len(record.seq) > 1000:
|
||||
print(record.id)
|
||||
```
|
||||
|
||||
### Dictionary-Based Access
|
||||
|
||||
Three approaches for random access:
|
||||
|
||||
**1. Bio.SeqIO.to_dict()** - Loads all records into memory:
|
||||
|
||||
```python
|
||||
seq_dict = SeqIO.to_dict(SeqIO.parse("sequences.fasta", "fasta"))
|
||||
record = seq_dict["sequence_id"]
|
||||
```
|
||||
|
||||
**2. Bio.SeqIO.index()** - Lazy-loaded dictionary (memory efficient):
|
||||
|
||||
```python
|
||||
seq_index = SeqIO.index("sequences.fasta", "fasta")
|
||||
record = seq_index["sequence_id"]
|
||||
seq_index.close()
|
||||
```
|
||||
|
||||
**3. Bio.SeqIO.index_db()** - SQLite-based index for very large files:
|
||||
|
||||
```python
|
||||
seq_index = SeqIO.index_db("index.idx", "sequences.fasta", "fasta")
|
||||
record = seq_index["sequence_id"]
|
||||
seq_index.close()
|
||||
```
|
||||
|
||||
### Low-Level Parsers for High Performance
|
||||
|
||||
For high-throughput sequencing data, use low-level parsers that return tuples instead of objects:
|
||||
|
||||
```python
|
||||
from Bio.SeqIO.FastaIO import SimpleFastaParser
|
||||
|
||||
with open("sequences.fasta") as handle:
|
||||
for title, sequence in SimpleFastaParser(handle):
|
||||
print(title, len(sequence))
|
||||
|
||||
from Bio.SeqIO.QualityIO import FastqGeneralIterator
|
||||
|
||||
with open("reads.fastq") as handle:
|
||||
for title, sequence, quality in FastqGeneralIterator(handle):
|
||||
print(title)
|
||||
```
|
||||
|
||||
## Compressed Files
|
||||
|
||||
Bio.SeqIO automatically handles compressed files:
|
||||
|
||||
```python
|
||||
# Works with gzip compression
|
||||
for record in SeqIO.parse("sequences.fasta.gz", "fasta"):
|
||||
print(record.id)
|
||||
|
||||
# BGZF format for random access
|
||||
from Bio import bgzf
|
||||
with bgzf.open("sequences.fasta.bgz", "r") as handle:
|
||||
records = SeqIO.parse(handle, "fasta")
|
||||
```
|
||||
|
||||
## Data Extraction Patterns
|
||||
|
||||
### Extract Specific Information
|
||||
|
||||
```python
|
||||
# Get all IDs
|
||||
ids = [record.id for record in SeqIO.parse("file.fasta", "fasta")]
|
||||
|
||||
# Get sequences above length threshold
|
||||
long_seqs = [record for record in SeqIO.parse("file.fasta", "fasta")
|
||||
if len(record.seq) > 500]
|
||||
|
||||
# Extract organism from GenBank
|
||||
for record in SeqIO.parse("file.gbk", "genbank"):
|
||||
organism = record.annotations.get("organism", "Unknown")
|
||||
print(f"{record.id}: {organism}")
|
||||
```
|
||||
|
||||
### Filter and Write
|
||||
|
||||
```python
|
||||
# Filter sequences by criteria
|
||||
long_sequences = (record for record in SeqIO.parse("input.fasta", "fasta")
|
||||
if len(record) > 500)
|
||||
SeqIO.write(long_sequences, "filtered.fasta", "fasta")
|
||||
```
|
||||
|
||||
## Best Practices
|
||||
|
||||
1. **Use iterators** for large files rather than loading everything into memory
|
||||
2. **Prefer index()** for repeated random access to large files
|
||||
3. **Use index_db()** for millions of records or multi-file scenarios
|
||||
4. **Use low-level parsers** for high-throughput data when speed is critical
|
||||
5. **Download once, reuse locally** rather than repeated network access
|
||||
6. **Close indexed files** explicitly or use context managers
|
||||
7. **Validate input** before writing with SeqIO.write()
|
||||
8. **Use appropriate format strings** - always lowercase (e.g., "fasta", not "FASTA")
|
||||
|
||||
## Common Use Cases
|
||||
|
||||
### Format Conversion
|
||||
|
||||
```python
|
||||
# GenBank to FASTA
|
||||
SeqIO.convert("input.gbk", "genbank", "output.fasta", "fasta")
|
||||
|
||||
# Multiple format conversion
|
||||
for fmt in ["fasta", "genbank", "embl"]:
|
||||
SeqIO.convert("input.fasta", "fasta", f"output.{fmt}", fmt)
|
||||
```
|
||||
|
||||
### Quality Filtering (FASTQ)
|
||||
|
||||
```python
|
||||
from Bio import SeqIO
|
||||
|
||||
good_reads = (record for record in SeqIO.parse("reads.fastq", "fastq")
|
||||
if min(record.letter_annotations["phred_quality"]) >= 20)
|
||||
count = SeqIO.write(good_reads, "filtered.fastq", "fastq")
|
||||
```
|
||||
|
||||
### Sequence Statistics
|
||||
|
||||
```python
|
||||
from Bio.SeqUtils import gc_fraction
|
||||
|
||||
for record in SeqIO.parse("sequences.fasta", "fasta"):
|
||||
gc = gc_fraction(record.seq)
|
||||
print(f"{record.id}: GC={gc:.2%}, Length={len(record)}")
|
||||
```
|
||||
|
||||
### Creating Records Programmatically
|
||||
|
||||
```python
|
||||
from Bio.Seq import Seq
|
||||
from Bio.SeqRecord import SeqRecord
|
||||
|
||||
# Create a new record
|
||||
new_record = SeqRecord(
|
||||
Seq("ATGCGATCGATCG"),
|
||||
id="seq001",
|
||||
name="MySequence",
|
||||
description="Test sequence"
|
||||
)
|
||||
|
||||
# Write to file
|
||||
SeqIO.write([new_record], "new.fasta", "fasta")
|
||||
```
|
||||
564
scientific-skills/biopython/references/structure.md
Normal file
564
scientific-skills/biopython/references/structure.md
Normal file
@@ -0,0 +1,564 @@
|
||||
# Structural Bioinformatics with Bio.PDB
|
||||
|
||||
## Overview
|
||||
|
||||
Bio.PDB provides tools for working with macromolecular 3D structures from PDB and mmCIF files. The module uses the SMCRA (Structure/Model/Chain/Residue/Atom) architecture to represent protein structures hierarchically.
|
||||
|
||||
## SMCRA Architecture
|
||||
|
||||
The Bio.PDB module organizes structures hierarchically:
|
||||
|
||||
```
|
||||
Structure
|
||||
└── Model (multiple models for NMR structures)
|
||||
└── Chain (e.g., chain A, B, C)
|
||||
└── Residue (amino acids, nucleotides, heteroatoms)
|
||||
└── Atom (individual atoms)
|
||||
```
|
||||
|
||||
## Parsing Structure Files
|
||||
|
||||
### PDB Format
|
||||
|
||||
```python
|
||||
from Bio.PDB import PDBParser
|
||||
|
||||
# Create parser
|
||||
parser = PDBParser(QUIET=True) # QUIET=True suppresses warnings
|
||||
|
||||
# Parse structure
|
||||
structure = parser.get_structure("1crn", "1crn.pdb")
|
||||
|
||||
# Access basic information
|
||||
print(f"Structure ID: {structure.id}")
|
||||
print(f"Number of models: {len(structure)}")
|
||||
```
|
||||
|
||||
### mmCIF Format
|
||||
|
||||
mmCIF format is more modern and handles large structures better:
|
||||
|
||||
```python
|
||||
from Bio.PDB import MMCIFParser
|
||||
|
||||
# Create parser
|
||||
parser = MMCIFParser(QUIET=True)
|
||||
|
||||
# Parse structure
|
||||
structure = parser.get_structure("1crn", "1crn.cif")
|
||||
```
|
||||
|
||||
### Download from PDB
|
||||
|
||||
```python
|
||||
from Bio.PDB import PDBList
|
||||
|
||||
# Create PDB list object
|
||||
pdbl = PDBList()
|
||||
|
||||
# Download PDB file
|
||||
pdbl.retrieve_pdb_file("1CRN", file_format="pdb", pdir="structures/")
|
||||
|
||||
# Download mmCIF file
|
||||
pdbl.retrieve_pdb_file("1CRN", file_format="mmCif", pdir="structures/")
|
||||
|
||||
# Download obsolete structure
|
||||
pdbl.retrieve_pdb_file("1CRN", obsolete=True, pdir="structures/")
|
||||
```
|
||||
|
||||
## Navigating Structure Hierarchy
|
||||
|
||||
### Access Models
|
||||
|
||||
```python
|
||||
# Get first model
|
||||
model = structure[0]
|
||||
|
||||
# Iterate through all models
|
||||
for model in structure:
|
||||
print(f"Model {model.id}")
|
||||
```
|
||||
|
||||
### Access Chains
|
||||
|
||||
```python
|
||||
# Get specific chain
|
||||
chain = model["A"]
|
||||
|
||||
# Iterate through all chains
|
||||
for chain in model:
|
||||
print(f"Chain {chain.id}")
|
||||
```
|
||||
|
||||
### Access Residues
|
||||
|
||||
```python
|
||||
# Iterate through residues in a chain
|
||||
for residue in chain:
|
||||
print(f"Residue: {residue.resname} {residue.id[1]}")
|
||||
|
||||
# Get specific residue by ID
|
||||
# Residue ID is tuple: (hetfield, sequence_id, insertion_code)
|
||||
residue = chain[(" ", 10, " ")] # Standard amino acid at position 10
|
||||
```
|
||||
|
||||
### Access Atoms
|
||||
|
||||
```python
|
||||
# Iterate through atoms in a residue
|
||||
for atom in residue:
|
||||
print(f"Atom: {atom.name}, Coordinates: {atom.coord}")
|
||||
|
||||
# Get specific atom
|
||||
ca_atom = residue["CA"] # Alpha carbon
|
||||
print(f"CA coordinates: {ca_atom.coord}")
|
||||
```
|
||||
|
||||
### Alternative Access Patterns
|
||||
|
||||
```python
|
||||
# Direct access through hierarchy
|
||||
atom = structure[0]["A"][10]["CA"]
|
||||
|
||||
# Get all atoms
|
||||
atoms = list(structure.get_atoms())
|
||||
print(f"Total atoms: {len(atoms)}")
|
||||
|
||||
# Get all residues
|
||||
residues = list(structure.get_residues())
|
||||
|
||||
# Get all chains
|
||||
chains = list(structure.get_chains())
|
||||
```
|
||||
|
||||
## Working with Atom Coordinates
|
||||
|
||||
### Accessing Coordinates
|
||||
|
||||
```python
|
||||
# Get atom coordinates
|
||||
coord = atom.coord
|
||||
print(f"X: {coord[0]}, Y: {coord[1]}, Z: {coord[2]}")
|
||||
|
||||
# Get B-factor (temperature factor)
|
||||
b_factor = atom.bfactor
|
||||
|
||||
# Get occupancy
|
||||
occupancy = atom.occupancy
|
||||
|
||||
# Get element
|
||||
element = atom.element
|
||||
```
|
||||
|
||||
### Calculate Distances
|
||||
|
||||
```python
|
||||
from Bio.PDB import Vector
|
||||
|
||||
# Calculate distance between two atoms
|
||||
atom1 = residue1["CA"]
|
||||
atom2 = residue2["CA"]
|
||||
|
||||
distance = atom1 - atom2 # Returns distance in Angstroms
|
||||
print(f"Distance: {distance:.2f} Å")
|
||||
```
|
||||
|
||||
### Calculate Angles
|
||||
|
||||
```python
|
||||
from Bio.PDB.vectors import calc_angle
|
||||
|
||||
# Calculate angle between three atoms
|
||||
angle = calc_angle(
|
||||
atom1.get_vector(),
|
||||
atom2.get_vector(),
|
||||
atom3.get_vector()
|
||||
)
|
||||
print(f"Angle: {angle:.2f} radians")
|
||||
```
|
||||
|
||||
### Calculate Dihedrals
|
||||
|
||||
```python
|
||||
from Bio.PDB.vectors import calc_dihedral
|
||||
|
||||
# Calculate dihedral angle between four atoms
|
||||
dihedral = calc_dihedral(
|
||||
atom1.get_vector(),
|
||||
atom2.get_vector(),
|
||||
atom3.get_vector(),
|
||||
atom4.get_vector()
|
||||
)
|
||||
print(f"Dihedral: {dihedral:.2f} radians")
|
||||
```
|
||||
|
||||
## Structure Analysis
|
||||
|
||||
### Secondary Structure (DSSP)
|
||||
|
||||
DSSP assigns secondary structure to protein structures:
|
||||
|
||||
```python
|
||||
from Bio.PDB import DSSP, PDBParser
|
||||
|
||||
# Parse structure
|
||||
parser = PDBParser()
|
||||
structure = parser.get_structure("1crn", "1crn.pdb")
|
||||
|
||||
# Run DSSP (requires DSSP executable installed)
|
||||
model = structure[0]
|
||||
dssp = DSSP(model, "1crn.pdb")
|
||||
|
||||
# Access results
|
||||
for residue_key in dssp:
|
||||
dssp_data = dssp[residue_key]
|
||||
residue_id = residue_key[1]
|
||||
ss = dssp_data[2] # Secondary structure code
|
||||
phi = dssp_data[4] # Phi angle
|
||||
psi = dssp_data[5] # Psi angle
|
||||
print(f"Residue {residue_id}: {ss}, φ={phi:.1f}°, ψ={psi:.1f}°")
|
||||
```
|
||||
|
||||
Secondary structure codes:
|
||||
- `H` - Alpha helix
|
||||
- `B` - Beta bridge
|
||||
- `E` - Strand
|
||||
- `G` - 3-10 helix
|
||||
- `I` - Pi helix
|
||||
- `T` - Turn
|
||||
- `S` - Bend
|
||||
- `-` - Coil/loop
|
||||
|
||||
### Solvent Accessibility (DSSP)
|
||||
|
||||
```python
|
||||
# Get relative solvent accessibility
|
||||
for residue_key in dssp:
|
||||
acc = dssp[residue_key][3] # Relative accessibility
|
||||
print(f"Residue {residue_key[1]}: {acc:.2f} relative accessibility")
|
||||
```
|
||||
|
||||
### Neighbor Search
|
||||
|
||||
Find nearby atoms efficiently:
|
||||
|
||||
```python
|
||||
from Bio.PDB import NeighborSearch
|
||||
|
||||
# Get all atoms
|
||||
atoms = list(structure.get_atoms())
|
||||
|
||||
# Create neighbor search object
|
||||
ns = NeighborSearch(atoms)
|
||||
|
||||
# Find atoms within radius
|
||||
center_atom = structure[0]["A"][10]["CA"]
|
||||
nearby_atoms = ns.search(center_atom.coord, 5.0) # 5 Å radius
|
||||
print(f"Found {len(nearby_atoms)} atoms within 5 Å")
|
||||
|
||||
# Find residues within radius
|
||||
nearby_residues = ns.search(center_atom.coord, 5.0, level="R")
|
||||
|
||||
# Find chains within radius
|
||||
nearby_chains = ns.search(center_atom.coord, 10.0, level="C")
|
||||
```
|
||||
|
||||
### Contact Map
|
||||
|
||||
```python
|
||||
def calculate_contact_map(chain, distance_threshold=8.0):
|
||||
"""Calculate residue-residue contact map."""
|
||||
residues = list(chain.get_residues())
|
||||
n = len(residues)
|
||||
contact_map = [[0] * n for _ in range(n)]
|
||||
|
||||
for i, res1 in enumerate(residues):
|
||||
for j, res2 in enumerate(residues):
|
||||
if i < j:
|
||||
# Get CA atoms
|
||||
if res1.has_id("CA") and res2.has_id("CA"):
|
||||
dist = res1["CA"] - res2["CA"]
|
||||
if dist < distance_threshold:
|
||||
contact_map[i][j] = 1
|
||||
contact_map[j][i] = 1
|
||||
|
||||
return contact_map
|
||||
```
|
||||
|
||||
## Structure Quality Assessment
|
||||
|
||||
### Ramachandran Plot Data
|
||||
|
||||
```python
|
||||
from Bio.PDB import Polypeptide
|
||||
|
||||
def get_phi_psi(structure):
|
||||
"""Extract phi and psi angles for Ramachandran plot."""
|
||||
phi_psi = []
|
||||
|
||||
for model in structure:
|
||||
for chain in model:
|
||||
polypeptides = Polypeptide.PPBuilder().build_peptides(chain)
|
||||
for poly in polypeptides:
|
||||
angles = poly.get_phi_psi_list()
|
||||
for residue, (phi, psi) in zip(poly, angles):
|
||||
if phi and psi: # Skip None values
|
||||
phi_psi.append((residue.resname, phi, psi))
|
||||
|
||||
return phi_psi
|
||||
```
|
||||
|
||||
### Check for Missing Atoms
|
||||
|
||||
```python
|
||||
def check_missing_atoms(structure):
|
||||
"""Identify residues with missing atoms."""
|
||||
missing = []
|
||||
|
||||
for residue in structure.get_residues():
|
||||
if residue.id[0] == " ": # Standard amino acid
|
||||
resname = residue.resname
|
||||
|
||||
# Expected backbone atoms
|
||||
expected = ["N", "CA", "C", "O"]
|
||||
|
||||
for atom_name in expected:
|
||||
if not residue.has_id(atom_name):
|
||||
missing.append((residue.full_id, atom_name))
|
||||
|
||||
return missing
|
||||
```
|
||||
|
||||
## Structure Manipulation
|
||||
|
||||
### Select Specific Atoms
|
||||
|
||||
```python
|
||||
from Bio.PDB import Select
|
||||
|
||||
class CASelect(Select):
|
||||
"""Select only CA atoms."""
|
||||
def accept_atom(self, atom):
|
||||
return atom.name == "CA"
|
||||
|
||||
class ChainASelect(Select):
|
||||
"""Select only chain A."""
|
||||
def accept_chain(self, chain):
|
||||
return chain.id == "A"
|
||||
|
||||
# Use with PDBIO
|
||||
from Bio.PDB import PDBIO
|
||||
|
||||
io = PDBIO()
|
||||
io.set_structure(structure)
|
||||
io.save("ca_only.pdb", CASelect())
|
||||
io.save("chain_a.pdb", ChainASelect())
|
||||
```
|
||||
|
||||
### Transform Structures
|
||||
|
||||
```python
|
||||
import numpy as np
|
||||
|
||||
# Rotate structure
|
||||
from Bio.PDB.vectors import rotaxis
|
||||
|
||||
# Define rotation axis and angle
|
||||
axis = Vector(1, 0, 0) # X-axis
|
||||
angle = np.pi / 4 # 45 degrees
|
||||
|
||||
# Create rotation matrix
|
||||
rotation = rotaxis(angle, axis)
|
||||
|
||||
# Apply rotation to all atoms
|
||||
for atom in structure.get_atoms():
|
||||
atom.transform(rotation, Vector(0, 0, 0))
|
||||
```
|
||||
|
||||
### Superimpose Structures
|
||||
|
||||
```python
|
||||
from Bio.PDB import Superimposer, PDBParser
|
||||
|
||||
# Parse two structures
|
||||
parser = PDBParser()
|
||||
structure1 = parser.get_structure("ref", "reference.pdb")
|
||||
structure2 = parser.get_structure("mov", "mobile.pdb")
|
||||
|
||||
# Get CA atoms from both structures
|
||||
ref_atoms = [atom for atom in structure1.get_atoms() if atom.name == "CA"]
|
||||
mov_atoms = [atom for atom in structure2.get_atoms() if atom.name == "CA"]
|
||||
|
||||
# Superimpose
|
||||
super_imposer = Superimposer()
|
||||
super_imposer.set_atoms(ref_atoms, mov_atoms)
|
||||
|
||||
# Apply transformation
|
||||
super_imposer.apply(structure2.get_atoms())
|
||||
|
||||
# Get RMSD
|
||||
rmsd = super_imposer.rms
|
||||
print(f"RMSD: {rmsd:.2f} Å")
|
||||
|
||||
# Save superimposed structure
|
||||
from Bio.PDB import PDBIO
|
||||
io = PDBIO()
|
||||
io.set_structure(structure2)
|
||||
io.save("superimposed.pdb")
|
||||
```
|
||||
|
||||
## Writing Structure Files
|
||||
|
||||
### Save PDB Files
|
||||
|
||||
```python
|
||||
from Bio.PDB import PDBIO
|
||||
|
||||
io = PDBIO()
|
||||
io.set_structure(structure)
|
||||
io.save("output.pdb")
|
||||
```
|
||||
|
||||
### Save mmCIF Files
|
||||
|
||||
```python
|
||||
from Bio.PDB import MMCIFIO
|
||||
|
||||
io = MMCIFIO()
|
||||
io.set_structure(structure)
|
||||
io.save("output.cif")
|
||||
```
|
||||
|
||||
## Sequence from Structure
|
||||
|
||||
### Extract Sequence
|
||||
|
||||
```python
|
||||
from Bio.PDB import Polypeptide
|
||||
|
||||
# Get polypeptides from structure
|
||||
ppb = Polypeptide.PPBuilder()
|
||||
|
||||
for model in structure:
|
||||
for chain in model:
|
||||
for pp in ppb.build_peptides(chain):
|
||||
sequence = pp.get_sequence()
|
||||
print(f"Chain {chain.id}: {sequence}")
|
||||
```
|
||||
|
||||
### Map to FASTA
|
||||
|
||||
```python
|
||||
from Bio import SeqIO
|
||||
from Bio.SeqRecord import SeqRecord
|
||||
|
||||
# Extract sequences and create FASTA
|
||||
records = []
|
||||
ppb = Polypeptide.PPBuilder()
|
||||
|
||||
for model in structure:
|
||||
for chain in model:
|
||||
for pp in ppb.build_peptides(chain):
|
||||
seq_record = SeqRecord(
|
||||
pp.get_sequence(),
|
||||
id=f"{structure.id}_{chain.id}",
|
||||
description=f"Chain {chain.id}"
|
||||
)
|
||||
records.append(seq_record)
|
||||
|
||||
SeqIO.write(records, "structure_sequences.fasta", "fasta")
|
||||
```
|
||||
|
||||
## Best Practices
|
||||
|
||||
1. **Use mmCIF** for large structures and modern data
|
||||
2. **Set QUIET=True** to suppress parser warnings
|
||||
3. **Check for missing atoms** before analysis
|
||||
4. **Use NeighborSearch** for efficient spatial queries
|
||||
5. **Validate structure quality** with DSSP or Ramachandran analysis
|
||||
6. **Handle multiple models** appropriately (NMR structures)
|
||||
7. **Be aware of heteroatoms** - they have different residue IDs
|
||||
8. **Use Select classes** for targeted structure output
|
||||
9. **Cache downloaded structures** locally
|
||||
10. **Consider alternative conformations** - some residues have multiple positions
|
||||
|
||||
## Common Use Cases
|
||||
|
||||
### Calculate RMSD Between Structures
|
||||
|
||||
```python
|
||||
from Bio.PDB import PDBParser, Superimposer
|
||||
|
||||
parser = PDBParser()
|
||||
structure1 = parser.get_structure("s1", "structure1.pdb")
|
||||
structure2 = parser.get_structure("s2", "structure2.pdb")
|
||||
|
||||
# Get CA atoms
|
||||
atoms1 = [atom for atom in structure1[0]["A"].get_atoms() if atom.name == "CA"]
|
||||
atoms2 = [atom for atom in structure2[0]["A"].get_atoms() if atom.name == "CA"]
|
||||
|
||||
# Ensure same number of atoms
|
||||
min_len = min(len(atoms1), len(atoms2))
|
||||
atoms1 = atoms1[:min_len]
|
||||
atoms2 = atoms2[:min_len]
|
||||
|
||||
# Calculate RMSD
|
||||
sup = Superimposer()
|
||||
sup.set_atoms(atoms1, atoms2)
|
||||
print(f"RMSD: {sup.rms:.3f} Å")
|
||||
```
|
||||
|
||||
### Find Binding Site Residues
|
||||
|
||||
```python
|
||||
def find_binding_site(structure, ligand_chain, ligand_res_id, distance=5.0):
|
||||
"""Find residues near a ligand."""
|
||||
from Bio.PDB import NeighborSearch
|
||||
|
||||
# Get ligand atoms
|
||||
ligand = structure[0][ligand_chain][ligand_res_id]
|
||||
ligand_atoms = list(ligand.get_atoms())
|
||||
|
||||
# Get all protein atoms
|
||||
protein_atoms = []
|
||||
for chain in structure[0]:
|
||||
if chain.id != ligand_chain:
|
||||
for residue in chain:
|
||||
if residue.id[0] == " ": # Standard residue
|
||||
protein_atoms.extend(residue.get_atoms())
|
||||
|
||||
# Find nearby atoms
|
||||
ns = NeighborSearch(protein_atoms)
|
||||
binding_site = set()
|
||||
|
||||
for ligand_atom in ligand_atoms:
|
||||
nearby = ns.search(ligand_atom.coord, distance, level="R")
|
||||
binding_site.update(nearby)
|
||||
|
||||
return list(binding_site)
|
||||
```
|
||||
|
||||
### Calculate Center of Mass
|
||||
|
||||
```python
|
||||
import numpy as np
|
||||
|
||||
def center_of_mass(entity):
|
||||
"""Calculate center of mass for structure entity."""
|
||||
masses = []
|
||||
coords = []
|
||||
|
||||
# Atomic masses (simplified)
|
||||
mass_dict = {"C": 12.0, "N": 14.0, "O": 16.0, "S": 32.0}
|
||||
|
||||
for atom in entity.get_atoms():
|
||||
mass = mass_dict.get(atom.element, 12.0)
|
||||
masses.append(mass)
|
||||
coords.append(atom.coord)
|
||||
|
||||
masses = np.array(masses)
|
||||
coords = np.array(coords)
|
||||
|
||||
com = np.sum(coords * masses[:, np.newaxis], axis=0) / np.sum(masses)
|
||||
return com
|
||||
```
|
||||
Reference in New Issue
Block a user