mirror of
https://github.com/K-Dense-AI/claude-scientific-skills.git
synced 2026-03-27 07:09:27 +08:00
578 lines
14 KiB
Markdown
578 lines
14 KiB
Markdown
# Advanced Biopython Features
|
|
|
|
## Sequence Motifs with Bio.motifs
|
|
|
|
### Creating Motifs
|
|
|
|
```python
|
|
from Bio import motifs
|
|
from Bio.Seq import Seq
|
|
|
|
# Create motif from instances
|
|
instances = [
|
|
Seq("TACAA"),
|
|
Seq("TACGC"),
|
|
Seq("TACAC"),
|
|
Seq("TACCC"),
|
|
Seq("AACCC"),
|
|
Seq("AATGC"),
|
|
Seq("AATGC"),
|
|
]
|
|
|
|
motif = motifs.create(instances)
|
|
```
|
|
|
|
### Motif Consensus and Degenerate Sequences
|
|
|
|
```python
|
|
# Get consensus sequence
|
|
print(motif.counts.consensus)
|
|
|
|
# Get degenerate consensus (IUPAC ambiguity codes)
|
|
print(motif.counts.degenerate_consensus)
|
|
|
|
# Access counts matrix
|
|
print(motif.counts)
|
|
```
|
|
|
|
### Position Weight Matrix (PWM)
|
|
|
|
```python
|
|
# Create position weight matrix
|
|
pwm = motif.counts.normalize(pseudocounts=0.5)
|
|
print(pwm)
|
|
|
|
# Calculate information content
|
|
ic = motif.counts.information_content()
|
|
print(f"Information content: {ic:.2f} bits")
|
|
```
|
|
|
|
### Searching for Motifs
|
|
|
|
```python
|
|
from Bio.Seq import Seq
|
|
|
|
# Search sequence for motif
|
|
test_seq = Seq("ATACAGGACAGACATACGCATACAACATTACAC")
|
|
|
|
# Get Position Specific Scoring Matrix (PSSM)
|
|
pssm = pwm.log_odds()
|
|
|
|
# Search sequence
|
|
for position, score in pssm.search(test_seq, threshold=5.0):
|
|
print(f"Position {position}: score = {score:.2f}")
|
|
```
|
|
|
|
### Reading Motifs from Files
|
|
|
|
```python
|
|
# Read motif from JASPAR format
|
|
with open("motif.jaspar") as handle:
|
|
motif = motifs.read(handle, "jaspar")
|
|
|
|
# Read multiple motifs
|
|
with open("motifs.jaspar") as handle:
|
|
for m in motifs.parse(handle, "jaspar"):
|
|
print(m.name)
|
|
|
|
# Supported formats: jaspar, meme, transfac, pfm
|
|
```
|
|
|
|
### Writing Motifs
|
|
|
|
```python
|
|
# Write motif in JASPAR format
|
|
with open("output.jaspar", "w") as handle:
|
|
handle.write(motif.format("jaspar"))
|
|
```
|
|
|
|
## Population Genetics with Bio.PopGen
|
|
|
|
### Working with GenePop Files
|
|
|
|
```python
|
|
from Bio.PopGen import GenePop
|
|
|
|
# Read GenePop file
|
|
with open("data.gen") as handle:
|
|
record = GenePop.read(handle)
|
|
|
|
# Access populations
|
|
print(f"Number of populations: {len(record.populations)}")
|
|
print(f"Loci: {record.loci_list}")
|
|
|
|
# Iterate through populations
|
|
for pop_idx, pop in enumerate(record.populations):
|
|
print(f"\nPopulation {pop_idx + 1}:")
|
|
for individual in pop:
|
|
print(f" {individual[0]}: {individual[1]}")
|
|
```
|
|
|
|
### Calculating Population Statistics
|
|
|
|
```python
|
|
from Bio.PopGen.GenePop.Controller import GenePopController
|
|
|
|
# Create controller
|
|
ctrl = GenePopController()
|
|
|
|
# Calculate basic statistics
|
|
result = ctrl.calc_allele_genotype_freqs("data.gen")
|
|
|
|
# Calculate Fst
|
|
fst_result = ctrl.calc_fst_all("data.gen")
|
|
print(f"Fst: {fst_result}")
|
|
|
|
# Test Hardy-Weinberg equilibrium
|
|
hw_result = ctrl.test_hw_pop("data.gen", "probability")
|
|
```
|
|
|
|
## Sequence Utilities with Bio.SeqUtils
|
|
|
|
### GC Content
|
|
|
|
```python
|
|
from Bio.SeqUtils import gc_fraction
|
|
from Bio.Seq import Seq
|
|
|
|
seq = Seq("ATCGATCGATCG")
|
|
gc = gc_fraction(seq)
|
|
print(f"GC content: {gc:.2%}")
|
|
```
|
|
|
|
### Molecular Weight
|
|
|
|
```python
|
|
from Bio.SeqUtils import molecular_weight
|
|
|
|
# DNA molecular weight
|
|
dna_seq = Seq("ATCG")
|
|
mw = molecular_weight(dna_seq, seq_type="DNA")
|
|
print(f"DNA MW: {mw:.2f} g/mol")
|
|
|
|
# Protein molecular weight
|
|
protein_seq = Seq("ACDEFGHIKLMNPQRSTVWY")
|
|
mw = molecular_weight(protein_seq, seq_type="protein")
|
|
print(f"Protein MW: {mw:.2f} Da")
|
|
```
|
|
|
|
### Melting Temperature
|
|
|
|
```python
|
|
from Bio.SeqUtils import MeltingTemp as mt
|
|
|
|
# Calculate Tm using nearest-neighbor method
|
|
seq = Seq("ATCGATCGATCG")
|
|
tm = mt.Tm_NN(seq)
|
|
print(f"Tm: {tm:.1f}°C")
|
|
|
|
# Use different salt concentration
|
|
tm = mt.Tm_NN(seq, Na=50, Mg=1.5) # 50 mM Na+, 1.5 mM Mg2+
|
|
|
|
# Wallace rule (for primers)
|
|
tm_wallace = mt.Tm_Wallace(seq)
|
|
```
|
|
|
|
### GC Skew
|
|
|
|
```python
|
|
from Bio.SeqUtils import gc_skew
|
|
|
|
# Calculate GC skew
|
|
seq = Seq("ATCGATCGGGCCCAAATTT")
|
|
skew = gc_skew(seq, window=100)
|
|
print(f"GC skew: {skew}")
|
|
```
|
|
|
|
### ProtParam - Protein Analysis
|
|
|
|
```python
|
|
from Bio.SeqUtils.ProtParam import ProteinAnalysis
|
|
|
|
protein_seq = "ACDEFGHIKLMNPQRSTVWY"
|
|
analyzed_seq = ProteinAnalysis(protein_seq)
|
|
|
|
# Molecular weight
|
|
print(f"MW: {analyzed_seq.molecular_weight():.2f} Da")
|
|
|
|
# Isoelectric point
|
|
print(f"pI: {analyzed_seq.isoelectric_point():.2f}")
|
|
|
|
# Amino acid composition
|
|
print(f"Composition: {analyzed_seq.get_amino_acids_percent()}")
|
|
|
|
# Instability index
|
|
print(f"Instability: {analyzed_seq.instability_index():.2f}")
|
|
|
|
# Aromaticity
|
|
print(f"Aromaticity: {analyzed_seq.aromaticity():.2f}")
|
|
|
|
# Secondary structure fraction
|
|
ss = analyzed_seq.secondary_structure_fraction()
|
|
print(f"Helix: {ss[0]:.2%}, Turn: {ss[1]:.2%}, Sheet: {ss[2]:.2%}")
|
|
|
|
# Extinction coefficient (assumes Cys reduced, no disulfide bonds)
|
|
print(f"Extinction coefficient: {analyzed_seq.molar_extinction_coefficient()}")
|
|
|
|
# Gravy (grand average of hydropathy)
|
|
print(f"GRAVY: {analyzed_seq.gravy():.3f}")
|
|
```
|
|
|
|
## Restriction Analysis with Bio.Restriction
|
|
|
|
```python
|
|
from Bio import Restriction
|
|
from Bio.Seq import Seq
|
|
|
|
# Analyze sequence for restriction sites
|
|
seq = Seq("GAATTCATCGATCGATGAATTC")
|
|
|
|
# Use specific enzyme
|
|
ecori = Restriction.EcoRI
|
|
sites = ecori.search(seq)
|
|
print(f"EcoRI sites at: {sites}")
|
|
|
|
# Use multiple enzymes
|
|
rb = Restriction.RestrictionBatch(["EcoRI", "BamHI", "PstI"])
|
|
results = rb.search(seq)
|
|
for enzyme, sites in results.items():
|
|
if sites:
|
|
print(f"{enzyme}: {sites}")
|
|
|
|
# Get all enzymes that cut sequence
|
|
all_enzymes = Restriction.Analysis(rb, seq)
|
|
print(f"Cutting enzymes: {all_enzymes.with_sites()}")
|
|
```
|
|
|
|
## Sequence Translation Tables
|
|
|
|
```python
|
|
from Bio.Data import CodonTable
|
|
|
|
# Standard genetic code
|
|
standard_table = CodonTable.unambiguous_dna_by_id[1]
|
|
print(standard_table)
|
|
|
|
# Mitochondrial code
|
|
mito_table = CodonTable.unambiguous_dna_by_id[2]
|
|
|
|
# Get specific codon
|
|
print(f"ATG codes for: {standard_table.forward_table['ATG']}")
|
|
|
|
# Get stop codons
|
|
print(f"Stop codons: {standard_table.stop_codons}")
|
|
|
|
# Get start codons
|
|
print(f"Start codons: {standard_table.start_codons}")
|
|
```
|
|
|
|
## Cluster Analysis with Bio.Cluster
|
|
|
|
```python
|
|
from Bio.Cluster import kcluster
|
|
import numpy as np
|
|
|
|
# Sample data matrix (genes x conditions)
|
|
data = np.array([
|
|
[1.2, 0.8, 0.5, 1.5],
|
|
[0.9, 1.1, 0.7, 1.3],
|
|
[0.2, 0.3, 2.1, 2.5],
|
|
[0.1, 0.4, 2.3, 2.2],
|
|
])
|
|
|
|
# Perform k-means clustering
|
|
clusterid, error, nfound = kcluster(data, nclusters=2)
|
|
print(f"Cluster assignments: {clusterid}")
|
|
print(f"Error: {error}")
|
|
```
|
|
|
|
## Genome Diagrams with GenomeDiagram
|
|
|
|
```python
|
|
from Bio.Graphics import GenomeDiagram
|
|
from Bio.SeqFeature import SeqFeature, FeatureLocation
|
|
from Bio import SeqIO
|
|
from reportlab.lib import colors
|
|
|
|
# Read GenBank file
|
|
record = SeqIO.read("sequence.gb", "genbank")
|
|
|
|
# Create diagram
|
|
gd_diagram = GenomeDiagram.Diagram("Genome Diagram")
|
|
gd_track = gd_diagram.new_track(1, greytrack=True)
|
|
gd_feature_set = gd_track.new_set()
|
|
|
|
# Add features
|
|
for feature in record.features:
|
|
if feature.type == "CDS":
|
|
color = colors.blue
|
|
elif feature.type == "gene":
|
|
color = colors.lightblue
|
|
else:
|
|
color = colors.grey
|
|
|
|
gd_feature_set.add_feature(
|
|
feature,
|
|
color=color,
|
|
label=True,
|
|
label_size=6,
|
|
label_angle=45
|
|
)
|
|
|
|
# Draw and save
|
|
gd_diagram.draw(format="linear", pagesize="A4", fragments=1)
|
|
gd_diagram.write("genome_diagram.pdf", "PDF")
|
|
```
|
|
|
|
## Sequence Comparison with Bio.pairwise2
|
|
|
|
**Note**: Bio.pairwise2 is deprecated. Use Bio.Align.PairwiseAligner instead (see alignment.md).
|
|
|
|
However, for legacy code:
|
|
|
|
```python
|
|
from Bio import pairwise2
|
|
from Bio.pairwise2 import format_alignment
|
|
|
|
# Global alignment
|
|
alignments = pairwise2.align.globalxx("ACCGT", "ACGT")
|
|
|
|
# Print top alignments
|
|
for alignment in alignments[:3]:
|
|
print(format_alignment(*alignment))
|
|
```
|
|
|
|
## Working with PubChem
|
|
|
|
```python
|
|
from Bio import Entrez
|
|
|
|
Entrez.email = "your.email@example.com"
|
|
|
|
# Search PubChem
|
|
handle = Entrez.esearch(db="pccompound", term="aspirin")
|
|
result = Entrez.read(handle)
|
|
handle.close()
|
|
|
|
compound_id = result["IdList"][0]
|
|
|
|
# Get compound information
|
|
handle = Entrez.efetch(db="pccompound", id=compound_id, retmode="xml")
|
|
compound_data = handle.read()
|
|
handle.close()
|
|
```
|
|
|
|
## Sequence Features with Bio.SeqFeature
|
|
|
|
```python
|
|
from Bio.SeqFeature import SeqFeature, FeatureLocation
|
|
from Bio.Seq import Seq
|
|
from Bio.SeqRecord import SeqRecord
|
|
|
|
# Create a feature
|
|
feature = SeqFeature(
|
|
location=FeatureLocation(start=10, end=50),
|
|
type="CDS",
|
|
strand=1,
|
|
qualifiers={"gene": ["ABC1"], "product": ["ABC protein"]}
|
|
)
|
|
|
|
# Add feature to record
|
|
record = SeqRecord(Seq("ATCG" * 20), id="seq1")
|
|
record.features.append(feature)
|
|
|
|
# Extract feature sequence
|
|
feature_seq = feature.extract(record.seq)
|
|
print(feature_seq)
|
|
```
|
|
|
|
## Sequence Ambiguity
|
|
|
|
```python
|
|
from Bio.Data import IUPACData
|
|
|
|
# DNA ambiguity codes
|
|
print(IUPACData.ambiguous_dna_letters)
|
|
|
|
# Protein ambiguity codes
|
|
print(IUPACData.ambiguous_protein_letters)
|
|
|
|
# Resolve ambiguous bases
|
|
print(IUPACData.ambiguous_dna_values["N"]) # Any base
|
|
print(IUPACData.ambiguous_dna_values["R"]) # A or G
|
|
```
|
|
|
|
## Quality Scores (FASTQ)
|
|
|
|
```python
|
|
from Bio import SeqIO
|
|
|
|
# Read FASTQ with quality scores
|
|
for record in SeqIO.parse("reads.fastq", "fastq"):
|
|
print(f"ID: {record.id}")
|
|
print(f"Sequence: {record.seq}")
|
|
print(f"Quality: {record.letter_annotations['phred_quality']}")
|
|
|
|
# Calculate average quality
|
|
avg_quality = sum(record.letter_annotations['phred_quality']) / len(record)
|
|
print(f"Average quality: {avg_quality:.2f}")
|
|
|
|
# Filter by quality
|
|
min_quality = min(record.letter_annotations['phred_quality'])
|
|
if min_quality >= 20:
|
|
print("High quality read")
|
|
```
|
|
|
|
## Best Practices
|
|
|
|
1. **Use appropriate modules** - Choose the right tool for your analysis
|
|
2. **Handle pseudocounts** - Important for motif analysis
|
|
3. **Validate input data** - Check file formats and data quality
|
|
4. **Consider performance** - Some operations can be computationally intensive
|
|
5. **Cache results** - Store intermediate results for large analyses
|
|
6. **Use proper genetic codes** - Select appropriate translation tables
|
|
7. **Document parameters** - Record thresholds and settings used
|
|
8. **Validate statistical results** - Understand limitations of tests
|
|
9. **Handle edge cases** - Check for empty results or invalid input
|
|
10. **Combine modules** - Leverage multiple Biopython tools together
|
|
|
|
## Common Use Cases
|
|
|
|
### Find ORFs
|
|
|
|
```python
|
|
from Bio import SeqIO
|
|
from Bio.SeqUtils import gc_fraction
|
|
|
|
def find_orfs(seq, min_length=100):
|
|
"""Find all ORFs in sequence."""
|
|
orfs = []
|
|
|
|
for strand, nuc in [(+1, seq), (-1, seq.reverse_complement())]:
|
|
for frame in range(3):
|
|
trans = nuc[frame:].translate()
|
|
trans_len = len(trans)
|
|
|
|
aa_start = 0
|
|
while aa_start < trans_len:
|
|
aa_end = trans.find("*", aa_start)
|
|
if aa_end == -1:
|
|
aa_end = trans_len
|
|
|
|
if aa_end - aa_start >= min_length // 3:
|
|
start = frame + aa_start * 3
|
|
end = frame + aa_end * 3
|
|
orfs.append({
|
|
'start': start,
|
|
'end': end,
|
|
'strand': strand,
|
|
'frame': frame,
|
|
'length': end - start,
|
|
'sequence': nuc[start:end]
|
|
})
|
|
|
|
aa_start = aa_end + 1
|
|
|
|
return orfs
|
|
|
|
# Use it
|
|
record = SeqIO.read("sequence.fasta", "fasta")
|
|
orfs = find_orfs(record.seq, min_length=300)
|
|
for orf in orfs:
|
|
print(f"ORF: {orf['start']}-{orf['end']}, strand={orf['strand']}, length={orf['length']}")
|
|
```
|
|
|
|
### Analyze Codon Usage
|
|
|
|
```python
|
|
from Bio import SeqIO
|
|
from Bio.SeqUtils import CodonUsage
|
|
|
|
def analyze_codon_usage(fasta_file):
|
|
"""Analyze codon usage in coding sequences."""
|
|
codon_counts = {}
|
|
|
|
for record in SeqIO.parse(fasta_file, "fasta"):
|
|
# Ensure sequence is multiple of 3
|
|
seq = record.seq[:len(record.seq) - len(record.seq) % 3]
|
|
|
|
# Count codons
|
|
for i in range(0, len(seq), 3):
|
|
codon = str(seq[i:i+3])
|
|
codon_counts[codon] = codon_counts.get(codon, 0) + 1
|
|
|
|
# Calculate frequencies
|
|
total = sum(codon_counts.values())
|
|
codon_freq = {k: v/total for k, v in codon_counts.items()}
|
|
|
|
return codon_freq
|
|
```
|
|
|
|
### Calculate Sequence Complexity
|
|
|
|
```python
|
|
def sequence_complexity(seq, k=2):
|
|
"""Calculate k-mer complexity (Shannon entropy)."""
|
|
import math
|
|
from collections import Counter
|
|
|
|
# Generate k-mers
|
|
kmers = [str(seq[i:i+k]) for i in range(len(seq) - k + 1)]
|
|
|
|
# Count k-mers
|
|
counts = Counter(kmers)
|
|
total = len(kmers)
|
|
|
|
# Calculate entropy
|
|
entropy = 0
|
|
for count in counts.values():
|
|
freq = count / total
|
|
entropy -= freq * math.log2(freq)
|
|
|
|
# Normalize by maximum possible entropy
|
|
max_entropy = math.log2(4 ** k) # For DNA
|
|
|
|
return entropy / max_entropy if max_entropy > 0 else 0
|
|
|
|
# Use it
|
|
from Bio.Seq import Seq
|
|
seq = Seq("ATCGATCGATCGATCG")
|
|
complexity = sequence_complexity(seq, k=2)
|
|
print(f"Sequence complexity: {complexity:.3f}")
|
|
```
|
|
|
|
### Extract Promoter Regions
|
|
|
|
```python
|
|
def extract_promoters(genbank_file, upstream=500):
|
|
"""Extract promoter regions upstream of genes."""
|
|
from Bio import SeqIO
|
|
|
|
record = SeqIO.read(genbank_file, "genbank")
|
|
promoters = []
|
|
|
|
for feature in record.features:
|
|
if feature.type == "gene":
|
|
if feature.strand == 1:
|
|
# Forward strand
|
|
start = max(0, feature.location.start - upstream)
|
|
end = feature.location.start
|
|
else:
|
|
# Reverse strand
|
|
start = feature.location.end
|
|
end = min(len(record.seq), feature.location.end + upstream)
|
|
|
|
promoter_seq = record.seq[start:end]
|
|
if feature.strand == -1:
|
|
promoter_seq = promoter_seq.reverse_complement()
|
|
|
|
promoters.append({
|
|
'gene': feature.qualifiers.get('gene', ['Unknown'])[0],
|
|
'sequence': promoter_seq,
|
|
'start': start,
|
|
'end': end
|
|
})
|
|
|
|
return promoters
|
|
```
|